/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 19 A certain cDNA of size 2 kb hybr... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A certain cDNA of size 2 kb hybridized to eight genomic fragments of total size \(30 \mathrm{kb}\) and contained two short ESTs. The ESTs were also found in two of the genomic fragments each of size \(2 \mathrm{kb}\). Sketch a possible explanation for these results.

Short Answer

Expert verified
The cDNA may hybridize with multiple genomic fragments due to gene duplication or repetitive sequences, with ESTs indicating conserved regions.

Step by step solution

01

Analyze the Problem

We need to understand the relationship between a specific cDNA, several genomic fragments, and ESTs (expressed sequence tags). The cDNA is 2 kb in size, and it hybridizes with genomic fragments that total 30 kb. Two ESTs are included within this cDNA, and each appears in two different genomic fragments sized at 2 kb each.
02

Determine Coverage

The 2 kb cDNA sequence hybridizes with genomic fragments totaling 30 kb. This suggests that multiple parts of the 2 kb cDNA correspond to different segments of genomic DNA due to hybridization across 8 fragments.
03

Understand the ESTs' Distribution

Since the two ESTs are found within the cDNA and they each appear in two different genomic fragments of 2 kb size, this indicates redundancy or repeated sequences present in the genome.
04

Consider Gene Duplication or Repetitive Elements

The presence of the ESTs in multiple fragments suggests either gene duplication events or repetitive elements in the genome that these ESTs could be a part of.
05

Sketch the Explanation

Imagine the 2 kb cDNA being divided among various genomic regions on the fragments. Each of the two 2 kb fragments contains sequences corresponding to the ESTs, showing that they are conserved or repeated in the genome, possibly due to gene duplication or repetitive sequences that are expressed.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Genomic Fragments
Genomic fragments are pieces of DNA that have been isolated from a larger genome. These fragments are used in various experiments to explore genetic relationships and structures within an organism's DNA. They can vary in size and contain specific genetic information that can be mapped back to its position within a genome.
For example, in cDNA hybridization, a small piece of complementary DNA (cDNA) is used as a probe to find matching sequences within genomic fragments.
This process helps researchers identify where certain genes are located and how they might interact with other sequences.
  • Genomic fragments help in locating specific genes within the vast stretch of genome.
  • They assist in understanding genetic variants and gene expression patterns.
  • Provides vital information for comparative genomics and evolutionary biology.
Expressed Sequence Tags (ESTs)
Expressed Sequence Tags, or ESTs, are short sub-sequences of cDNA. They provide information about gene expression, which means they help identify active genes in a genome at a particular time. ESTs are derived from mRNA and are a good indicator of which parts of the genome are transcribed and translated into proteins.
In our scenario, the ESTs are found within both the cDNA and multiple genomic fragments, suggesting these sequences are significant and possibly involved in crucial biological functions.
  • ESTs act as a snapshot of gene activity at specific states of an organism.
  • Useful for annotating genes on a genomic map.
  • Helps in discovering novel genes and understanding gene function.
Gene Duplication
Gene duplication is a common event in the evolution of genomes and refers to the process through which a segment of genetic material or an entire gene is copied to create two identical sequences. This can lead to genetic redundancy, but it also provides raw material for the development of new gene functions over time.
In our example, the fact that parts of the cDNA correspond to multiple genomic fragments and that ESTs are found in multiple locations suggests gene duplication could explain these redundancies.
  • Gene duplication allows for genetic diversity and adaptation.
  • Helps in the evolution of new gene functions and traits.
  • Plays a key role in increasing genetic complexity within an organism.
Repetitive Elements
Repetitive elements are sequences that occur multiple times in the genome. They can be found in many organisms and play significant roles in genome organization and evolution. The presence of these repeated sequences can facilitate mispairing during DNA replication, resulting in structural genomic variations.
In the case described, if cDNA hybridizes with multiple genomics fragments due to the presence of repetitive elements, it would suggest that these sequences are present at several locations within the genome.
  • Repetitive elements contribute to genome size and variation.
  • May drive genomic rearrangements and thus influence evolution.
  • Help researchers identify regions of the genome that may have regulatory significance.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

In browsing through the chimpanzee genome, you find that it has three homologs of a particular gene, whereas humans have only two. a. What are two alternative explanations for this observation? b. How could you distinguish between these two possibilities?

Sometimes, cDNAs turn out to be "chimeras"; that is, fusions of DNA copies of two different mRNAs accidentally inserted adjacently to each other in the same clone. You suspect that a cDNA clone from the nematode Caenorhabditis elegans is such a chimera because the sequence of the cDNA insert predicts a protein with two structural domains not normally observed in the same protein. How would you use the availability of the entire genomic sequence to assess if this cDNA clone is a monster or not?

You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2: AACAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAGATGCGATCTGTGAGCCGAG Read 4: TGTCTGCCATTCTTAAAAACAAAAATGT Read 5: TGTTATTTTTATTTCAGATGCGA Read 6: AACAAAAATGTTGTTATT a. Use these six sequence reads to create a sequence contig of this part of the \(H\). sapiens genome. b. Translate the sequence contig in all possible reading frames. c. Go to the BLAST page of the National Center for Biotechnology Information, or NCBI (htrps//www.ncbi nlm.nih gov/BLAST/, Appendix B) and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for proteinprotein comparison (BLASTp).

Some exons in the human genome are quite small (less than 75 bp long. Identification of such "microexons" is difficult because these distances are too short to reliably use ORF identification or codon bias to determine if small genomic sequences are truly part of an mRNA and a polypeptide. What techniques of "gene finding" can be used to try to assess if a given region of \(75 \mathrm{bp}\) constitutes an exon?

To inactivate a gene by RNAi, what information do you need? Do you need the map position of the target gene?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.