/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 18 Is a bacterial operator a bindin... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Is a bacterial operator a binding site?

Short Answer

Expert verified
Yes, a bacterial operator is a type of binding site for proteins.

Step by step solution

01

Define a Bacterial Operator

In molecular biology, a bacterial operator is a specific DNA sequence. It acts as a regulatory element that can interact with proteins, particularly repressors. This interaction controls the transcription of adjacent genes.
02

Understand Binding Site

A binding site is a region on DNA where specific proteins can bind. Proteins such as transcription factors, repressors, or activators attach to these sites to regulate gene expression.
03

Correlate Operator and Binding Site

A bacterial operator functions as a binding site. It is where specific proteins, primarily repressors, attach to influence gene transcription. This indicates that an operator is indeed a type of binding site used for regulatory purposes.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Understanding Binding Sites
A binding site is a special area on DNA where certain proteins can attach. These proteins include transcription factors, repressors, and activators. They play an essential role in managing how genes are expressed. When a protein binds to a DNA binding site, it can either enhance or block the transcription of genes, which is the process of making RNA from DNA.

Think of binding sites as control panels on the DNA. Things like light switches that affect whether genes are turned on or off. When a gene is needed, the proteins activate the gene by "flipping the switch" on the binding site. If the gene should remain silent, proteins bind in a way that keeps the switch off.
Role of Regulatory Elements
Regulatory elements are sequences in the DNA that exert control over gene transcription. They do this by serving as docking points for proteins. There are various kinds of regulatory elements, including promoters, enhancers, silencers, and operators, each with their specific function in gene regulation.

Operators are one type of regulatory element, particularly important in bacteria. They function by interacting with repressor proteins to control gene expression.
  • Promoters initiate transcription by helping RNA polymerase start gene transcription.
  • Enhancers increase transcription levels, often assisting promoters.
  • Silencers decrease transcription, effectively dimming the gene's "volume."
Regulatory elements are crucial not just for switching genes on or off but also for ensuring that genes are expressed at the right time and in the right amount.
The Mechanics of Gene Transcription
Gene transcription is the process of turning DNA instructions into RNA. It's a vital step in gene expression, with well-coordinated stages involving several players, including DNA, RNA polymerase, and various regulatory proteins.

Here's how it works: a segment of DNA unwinds, exposing the gene sequence. RNA polymerase attaches to a promoter region and starts reading the DNA to synthesize RNA. This RNA can then be used to create proteins that perform various functions in the cell.
  • Transcription starts with RNA polymerase binding to the promoter.
  • It proceeds through the gene, unwinding DNA as it moves.
  • The RNA synthesized is complementary to the DNA template strand.
Importantly, the rate and initiation of transcription are tightly regulated. Regulatory elements like operators play a significant role, especially in bacteria, by controlling when transcription can commence or be halted.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A certain cDNA of size 2 kb hybridized to eight genomic fragments of total size \(30 \mathrm{kb}\) and contained two short ESTs. The ESTs were also found in two of the genomic fragments each of size \(2 \mathrm{kb}\). Sketch a possible explanation for these results.

What is the difference between a contig and a scaffold?

You have the following sequence reads from a genomic clone of the Drosophila melanogaster genome: Read 1: TGGCCGTGATGGGCAGTTCCGGTG Read 2: TTCCGGTGCCGGAAAGA Read \(3: \mathrm{CTATCCGGGCGAACTTTTGGCCG}\) Read 4: CGTGATGGGCAGTTCCGGTG Read 5: TTGGCCGTGATGGGCAGTT Read 6: CGAACTTTTGGCCGTGATGGGCAGTTCC Use these six sequence reads to create a sequence contig of this part of the \(D\). melanogaster genome.

A sequenced fragment of DNA in Drasophila was used in a BL.AST search. The best (closest) match was to a kinase gene from Neuraspora. Does this match mean that the Drosophila sequence contains a kinase gene?

The entire genome of the yeast Saccharomyces cerevisiae has been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-size sequences with appropriate translational initiation and termination signals) in the genome. Some of these ORFs are previously known genes with established functions; however, the remainder are unassigned reading frames (URF). To deduce the possible functions of the URFs, they are being systematically, one at a time, converted into null alleles by in vitro knockout techniques. The results are as follows: 15 percent are lethal when knocked out. 25 percent show some mutant phenotype (altered morphology, altered nutrition, and so forth). 60 percent show no detectable mutant phenotype at all and resemble wild type. Explain the possible molecular-genetic basis of these three mutant categories, inventing examples where possible.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.