/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 16 In an in situ hybridization expe... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

In an in situ hybridization experiment, a certain clone bound to only the X chromosome in a boy with no disease symptoms. However, in a boy with Duchenne muscular dystrophy (X-linked recessive disease), it bound to the X chromosome and to an autosome. Explain. Could this clone be useful in isolating the gene for Duchenne muscular dystrophy?

Short Answer

Expert verified
Yes, the clone could help identify rearranged regions linked to Duchenne muscular dystrophy.

Step by step solution

01

Understanding the Experiment

In situ hybridization is a technique used to locate specific DNA sequences on chromosomes. In this experiment, a clone is binding to an X chromosome in a healthy boy and to both an X chromosome and an autosome in a boy with Duchenne muscular dystrophy.
02

Analyzing Binding Patterns

The binding of the clone to only the X chromosome in a boy with no disease suggests the clone is targeted towards sequences typically found on X chromosomes. In a boy with Duchenne muscular dystrophy, the clone's additional binding to an autosome implies a genomic aberration causing the autosome to have a region similar enough to bind the clone.
03

Implications of Clone Binding

The clone's dual binding in the symptomatic boy suggests a translocation or similar rearrangement involving the X chromosome and an autosome. This rearrangement may play a role in the manifestation of the disease symptoms, indicating a genetic anomaly.
04

Evaluating Usefulness for Gene Isolation

Since the clone binds to a potentially rearranged sequence in Duchenne muscular dystrophy cases, this clone might be useful in isolating or identifying regions of interest related to the disease. Its binding pattern highlights areas that might possess relevant genetic material owing to their anomalous positioning in diseased individuals.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

X-linked Recessive Disease
X-linked recessive diseases are genetic disorders that are carried on the X chromosome. These disorders typically manifest more frequently in males than females due to the difference in their chromosomal makeup. Males possess one X and one Y chromosome, while females have two X chromosomes.

Because males have only one X chromosome, any recessive mutation on it is more likely to express itself since there isn't another X chromosome to counteract the recessive allele. In contrast, females would need to have two copies of the mutated gene to express the disorder, which is statistically less probable.
  • An example of such a disease is Hemophilia.
  • Another example is Duchenne muscular dystrophy, where the lack of dystrophin affects muscle strength and integrity.
Mothers often pass these disorders onto their sons, since they contribute an X chromosome, whereas fathers contribute a Y chromosome to their male offspring. Understanding the pattern of inheritance for X-linked recessive diseases is crucial in genetic counseling and risk assessment for families affected by such disorders.
Genomic Aberration
Genomic aberrations refer to changes or mutations in the genome that alter normal cellular processes. These can be as small as point mutations or as large as chromosomal rearrangements, such as duplications, deletions, or translocations.

Such changes can significantly impact gene expression and function, leading to various health conditions. In the context of in situ hybridization experiments, observing unexpected binding patterns indicates possible genomic aberrations.
  • Translocations occur when segments of chromosomes are rearranged between non-homologous chromosomes.
  • These rearrangements can be implicated in diseases if they disrupt normal gene function.
In Duchenne muscular dystrophy, if a clone binds to an unexpected region, this might suggest a translocation involving the X chromosome and an autosome. Identifying and understanding these aberrations is crucial because they can reveal the underlying genetic anomalies responsible for certain diseases, including X-linked recessive ones like Duchenne muscular dystrophy.
Gene Isolation
Gene isolation is a vital process in molecular genetics aimed at identifying and separating DNA sequences of interest from the rest of the genome. This process allows researchers to study specific genetic functions and their role in diseases. Techniques like in situ hybridization aid in gene isolation by pinpointing where specific sequences are located on chromosomes.

The importance of gene isolation cannot be overstated, especially in understanding hereditary diseases. By isolating the genes involved, researchers can gain insights into the mechanisms by which these genes cause disease and potentially develop targeted treatments.
  • It can help in creating genetic maps and understanding gene expression patterns.
  • Targeted gene therapy becomes a possibility once the critical genetic regions are understood.
In diseases such as Duchenne muscular dystrophy, isolating the culprit gene can be pivotal, offering pathways for innovative treatments and interventions.
Duchenne Muscular Dystrophy
Duchenne Muscular Dystrophy (DMD) is a severe type of muscular dystrophy characterized by rapid muscle degeneration and weakness. This condition primarily affects boys due to its X-linked recessive inheritance pattern.

DMD is caused by mutations in the DMD gene, which encodes the protein dystrophin. Dystrophin plays a crucial role in maintaining the structural integrity of muscle cells. Without adequate dystrophin, muscle cells weaken and deteriorate over time, leading to the symptoms observed in DMD.
  • Early symptoms may include difficulty walking, frequent falls, and muscle stiffness.
  • As the disease progresses, patients may lose the ability to walk and suffer from respiratory and cardiac complications.
There is currently no cure for DMD, but treatments such as physiotherapy, corticosteroids, and assistive devices can help manage symptoms and improve quality of life. Research continues into new therapies, including gene therapy and exon skipping, aiming for more effective solutions.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

What is the difference between forward and reverse genetics?

You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2: AACAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAGATGCGATCTGTGAGCCGAG Read 4: TGTCTGCCATTCTTAAAAACAAAAATGT Read 5: TGTTATTTTTATTTCAGATGCGA Read 6: AACAAAAATGTTGTTATT a. Use these six sequence reads to create a sequence contig of this part of the \(H\). sapiens genome. b. Translate the sequence contig in all possible reading frames. c. Go to the BLAST page of the National Center for Biotechnology Information, or NCBI (htrps//www.ncbi nlm.nih gov/BLAST/, Appendix B) and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for proteinprotein comparison (BLASTp).

You have the following sequence reads from a genomic clone of the Drosophila melanogaster genome: Read 1: TGGCCGTGATGGGCAGTTCCGGTG Read 2: TTCCGGTGCCGGAAAGA Read \(3: \mathrm{CTATCCGGGCGAACTTTTGGCCG}\) Read 4: CGTGATGGGCAGTTCCGGTG Read 5: TTGGCCGTGATGGGCAGTT Read 6: CGAACTTTTGGCCGTGATGGGCAGTTCC Use these six sequence reads to create a sequence contig of this part of the \(D\). melanogaster genome.

To inactivate a gene by RNAi, what information do you need? Do you need the map position of the target gene?

Sometimes, cDNAs turn out to be "chimeras"; that is, fusions of DNA copies of two different mRNAs accidentally inserted adjacently to each other in the same clone. You suspect that a cDNA clone from the nematode Caenorhabditis elegans is such a chimera because the sequence of the cDNA insert predicts a protein with two structural domains not normally observed in the same protein. How would you use the availability of the entire genomic sequence to assess if this cDNA clone is a monster or not?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.