/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Genetics: A Conceptual Approach Chapter 20 - (Page 3) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 28

A linear piece of DNA was broken into random, overlapping fragments, and each fragment was sequenced. The sequence of each fragment is shown below. Fragment \(1: 5^{\prime}-\mathrm{TAGTTAAAAC}-3^{\prime}\) Fragment \(2: 5^{\prime}-\mathrm{ACCGCAATACCCTAGTTAAA}-3^{\prime}\) Fragment \(3: 5^{\prime}-\mathrm{C C C T A G T T A A A A C}-3^{\prime}\) Fragment \(4: 5^{\prime}-\mathrm{ACCGCAATACCCTAGTT}-3^{\prime}\) Fragment \(5: 5^{\prime}-\mathrm{ACCGCAATACCCTAGTTAAA}-3^{\prime}\) Fragment \(6: 5^{\prime}-\mathrm{ATTTACCGCAAT}-3^{\prime}\) On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.

Problem 29

In Chapter 11 , we discussed three different types of sequences found in eukaryotic genomes: unique sequence DNA, moderately repetitive DNA, and highly repetitive DNA. Which of these sequences do you think would be most difficult to assemble into a complete genome sequence and why?

Problem 30

How does the density of genes found on chromosome 22 compare with the density of genes found on chromosome 21 , two similar-sized chromosomes? How does the number of genes on chromosome 22 compare with the number found on the \(Y\) chromosome? To answer these questions, go to www.ensembl.org. Under the heading Species, select Human. On the next page, click on View Karyotype. Pictures of the human chromosomes will appear. Click on chromosome 22 and select Chromosome Summary. You will be shown a picture of this chromosome and histograms of known genes (colored bars). The total numbers of coding (protein-encoding) genes, along with the chromosome length in base pairs, are given in the table at the bottom of the diagram. Write down the total length of the chromosome and the number of coding genes. Now go to chromosome 21 by selecting it from the Change Chromosome drop-down. Examine the total length and total number of protein-encoding genes for chromosome \(21 .\) Now do the same for the \(\mathrm{Y}\) chromosome. Calculate the gene density (number of genes/length) for chromosomes 22, 21, and Y. a. Which chromosome has the highest density and greatest number of genes? Which has the fewest? b. Examine in more detail the genes at the tip of the short arm of the Y chromosome by clicking on the top bar in the histogram of genes. Jump to location view. A more detailed view will be shown. What known genes are found in this region? How many protein-encoding genes are there in this region?

Problem 31

In recent years, honeybee colonies throughout North America have been decimated by colony collapse disorder (CCD), which results in the rapid deaths of worker bees. First noticed by beekeepers in \(2004,\) the disorder has been responsible for the loss of \(50 \%\) to \(90 \%\) of beekeeping operations in the United States. Evidence suggests that CCD is caused by a pathogen. Diana Cox-Foster and her colleagues (D. Cox-Foster et al. 2007. Science \(318: 283-287)\) used a metagenomic approach to try to identify the causative agent of CCD by isolating DNA from normal honeybee hives and from hives that had experienced CCD. A number of different bacteria, fungi, and viruses were identified in the metagenomic analysis. The following table gives the percentage of CCD hives and non-CCD hives that tested positive for four potential pathogens identified in the metagenomic analysis. On the basis of these data, which potential pathogen appears most likely to be responsible for CCD? Explain your reasoning. Do these data prove that this pathogen is the cause of CCD? Explain. $$ \begin{array}{lcc} \begin{array}{l} \text { Potential } \\ \text { pathogen } \end{array} & \begin{array}{c} \text { CCD hives } \\ \text { infected }(n=30) \end{array} & \begin{array}{c} \text { Non-CCD hives } \\ \text { infected }(n=21) \end{array} \\ \hline \begin{array}{l} \text { Israeli acute } \\ \text { paralysis virus } \end{array} & 83\% &4.8 \% \\\\\hline \text { Kashmir bee virus } & 100 \% & 76.2 \% \\\\\hline \text { Nosema apis } & 90 \% & 47.6 \% \\\\\hline \text { Nosema cernae } & 100 \% & 80.8 \%\\\ \hline \end{array} $$

Problem 33

James Noonan and his colleagues (J. Noonan et al. 2005. Science 309:597- 599) set out to study the genome sequence of an extinct species of cave bear. They extracted DNA from 40,000 -year-old bones of a cave bear and used a metagenomic approach to isolate, identify, and sequence the cave-bear DNA. Why did they use a metagenomic approach when their objective was to sequence the genome of one species (the cave bear)?

Problem 40

Much research has been devoted to developing methods for detecting, sequencing, and measuring levels of RNA (see Chapters 23 and 13) within the cell. All RNA is transcribed from DNA, so what information does RNA provide that is not found in DNA sequences? Give at least three examples.

Problem 41

Ribosomal RNAs are the most abundant RNAs in the cell. In experiments looking at levels of gene expression in different cell types, rRNAs are generally removed before carrying out RNA sequencing. Why might this be a useful step in these experiments? Why are researchers often less interested in rRNA than in other types of RNA?

Problem 42

What might be some advantages of using CRISPR-Cas (see Chapter 19) for carrying out mutagenesis screens?

Problem 48

A scientist determines the complete genomes and proteomes of a liver cell and a muscle cell from the same person. Would you expect bigger differences in the genomes or in the proteomes of these two cell types? Explain your answer.

Problem 49

Most organisms produce many more types of proteins than there are genes in their genome. Explain how there can be more proteins than genes, when all proteins must be encoded by DNA sequences.

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks