/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 28 A linear piece of DNA was broken... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A linear piece of DNA was broken into random, overlapping fragments, and each fragment was sequenced. The sequence of each fragment is shown below. Fragment \(1: 5^{\prime}-\mathrm{TAGTTAAAAC}-3^{\prime}\) Fragment \(2: 5^{\prime}-\mathrm{ACCGCAATACCCTAGTTAAA}-3^{\prime}\) Fragment \(3: 5^{\prime}-\mathrm{C C C T A G T T A A A A C}-3^{\prime}\) Fragment \(4: 5^{\prime}-\mathrm{ACCGCAATACCCTAGTT}-3^{\prime}\) Fragment \(5: 5^{\prime}-\mathrm{ACCGCAATACCCTAGTTAAA}-3^{\prime}\) Fragment \(6: 5^{\prime}-\mathrm{ATTTACCGCAAT}-3^{\prime}\) On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.

Short Answer

Expert verified
The original DNA sequence is \(5^{\prime}-\mathrm{ATTTACCGCAATACCCTAGTTAAAAC}-3^{\prime}\).

Step by step solution

01

Identify the Longest Fragment

Start by identifying the longest fragment among the given sequences. Fragment 2 (\(5^{\prime}-\mathrm{ACCGCAATACCCTAGTTAAA}-3^{\prime}\)) has the longest sequence with 19 nucleotides.
02

Find Overlaps with the Longest Fragment

Look for other fragments that overlap with any part of Fragment 2. All fragments have overlaps: Fragment 1 and Fragment 3 share 'TAGTTAAA', Fragment 4 shares 'ACCGCAATACCCTAGTT', and Fragment 5 is identical to Fragment 2.
03

Extend the Contig with an Additional Overlapping Fragment

Fragment 6 has a partial overlap with Fragment 2 at 'ATTTACCGCAAT'. Extending at 'ATTT' to 'AAAAC' from Fragment 1 and 'ATTT' from Fragment 6 gives the sequence: \(5^{\prime}-\mathrm{ATTTACCGCAATACCCTAGTTAAAAC}-3^{\prime}\).
04

Check for Full Sequence and Overlaps

Ensure no fragments are left out. All fragments were either matched fully or overlapped with others, confirming that the final sequence is correct and complete: \(5^{\prime}-\mathrm{ATTTACCGCAATACCCTAGTTAAAAC}-3^{\prime}\).

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Contig Formation
Contig formation is a crucial step in DNA sequencing. It involves assembling overlapping DNA fragments into a continuous sequence. The goal is to reconstruct the original DNA sequence by joining fragments based on their overlapping regions. This process often starts by identifying the longest fragment, establishing it as the backbone. Other fragments are then matched against it to find overlapping sequences.
Once overlaps are identified, the fragments are connected, ensuring smooth transitions from one fragment to another. The challenge lies in correctly determining these overlaps, as mistakes can lead to incorrect DNA sequencing.
  • Identify the longest read to serve as a backbone.
  • Find overlaps logically that extend the sequence without errors.
  • Ensure no gaps or ambiguities in the combined sequence.
By methodically piecing together fragments, scientists can accurately reconstruct DNA, providing vital insights into genetic information.
Fragment Overlaps
Fragment overlaps refer to the regions where two DNA segments share the same sequence. Identifying these overlaps is crucial for assembling the complete DNA sequence. Each fragment might have several overlapping possibilities with others, but correctly identifying these overlaps is key to successful genome assembly.
To find overlaps, compare each fragment to others and look for shared sequences at the ends of fragments. These matching regions, known as overlaps, guide where to connect fragments. Precision is essential here, as incorrect overlaps can lead to errors in the DNA sequence.
  • Look for shared sequences at fragment ends.
  • Use overlaps to guide fragment connections.
  • Verify overlaps to avoid sequencing errors.
By focusing on overlap accuracy, researchers ensure that the resulting DNA sequence reflects the original genetic material accurately.
Nucleotide Sequencing
Nucleotide sequencing is the process of determining the exact order of nucleotides within a DNA molecule. Nucleotides—the building blocks of DNA—comprise four types: adenine (A), thymine (T), cytosine (C), and guanine (G). Sequencing provides the order of these nucleotides, which is unique to every organism.
Nucleotide sequencing begins with breaking DNA into smaller fragments. Each fragment is then sequenced, determining its specific nucleotide order. These sequences are later assembled to recreate the original DNA sequence, using techniques such as contig formation and detecting fragment overlaps.
  • Identify the nucleotide order within DNA fragments.
  • Use sequencing data to establish overall DNA structure.
  • Ensure accuracy through verification processes.
Nucleotide sequencing is fundamental for genomic studies, enabling researchers to explore genetic information and understand biological functions.
Genome Assembly
Genome assembly is the process of piecing together DNA sequences to represent the original genome of an organism. It involves integrating several sequenced DNA fragments into a larger sequence. This is crucial for understanding genetics and detecting variations in DNA.
Genome assembly typically starts with high-throughput sequencing that generates numerous short DNA reads. These reads often overlap, enabling researchers to connect and assemble them into longer continuous sequences called contigs. The ultimate goal of genome assembly is to reconstruct the full genome with minimal errors.
  • Generate short DNA reads through sequencing technology.
  • Assemble reads into contigs by identifying overlaps.
  • Connect contigs into a complete genome sequence.
The assembly of a genome provides immense insights into biological functions, aids in discovering genetic diseases, and enhances our understanding of evolutionary processes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.