/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 20 What is a segmental duplication?... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

What is a segmental duplication?

Short Answer

Expert verified
A segmental duplication is a genomic region with long, highly similar duplicated sequences occurring multiple times in the genome.

Step by step solution

01

Define Segmental Duplication

Segmental duplication, also known as low-copy repeats (LCRs), refers to genomic regions where long sequences of DNA are duplicated and occur more than once within a genome. These sequences are typically at least 1 kilobase (kb) in length and have a high degree of sequence identity, usually greater than 90%, between the duplicated segments.
02

Characteristics of Segmental Duplications

Segmental duplications are known for their potential to cause misalignment during meiosis, which can result in duplications, deletions, and rearrangements of genomic sequences. This is because the high similarity of the segments makes it difficult for the DNA repair machinery to correctly align homologous chromosomes.
03

Functional Implications

These duplications can have significant evolutionary and functional impacts on the genome. They may contribute to genomic diversity but also underlie various genomic disorders if unequal crossing over occurs in these regions.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Low-Copy Repeats
Low-copy repeats, or LCRs, are specific segments of DNA that have been duplicated in the genome. Unlike simple repetitive sequences, such as those consisting of few base pairs repeated over and over, LCRs are typically longer, often exceeding 1 kilobase in length.
These copies have a high degree of similarity, generally over 90%, among them. LCRs occur in multiple locations in the genome, and their presence can lead to genetic rearrangements during cell division processes. These rearrangements can include duplications, deletions, and inversions due to mispairing and misalignment. Because they are not found in high numbers like other types of repeated sequences, they are dubbed "low-copy repeats."
Understanding LCRs is essential to studying how genetic diversity arises in a population and also in diagnosing certain genetic disorders linked to these regions.
Genomic Sequences
Genomic sequences refer to the complete DNA sequence of an organism. It is essentially the blueprint for all biological information in the organism. In eukaryotic organisms like humans, genomic sequences are divided into coding regions, which produce proteins, and non-coding regions, which may play a role in regulation and structural support. Segmental duplications, or LCRs, are part of these genomic sequences. They affect how genes are aligned and can cause shifts or errors in the replication and repair processes. Although only a small portion of the genome is made up of segmental duplications, these sections can have substantial effects.
When researchers study genomic sequences, they often focus on understanding how these segmental duplications can affect the normal function and structure of the genome.
Genomic Diversity
Genomic diversity refers to the variety of genetic make-ups within a population. It is an important aspect of biodiversity and evolutionary biology because it influences an organism's ability to adapt to changing environments. Segmental duplications contribute significantly to genomic diversity. They create variations in the number and arrangement of genes within the genome. These variations can result in unique traits and abilities within a population, potentially aiding in survival and adaptation. However, they can also make certain genomes more susceptible to errors during DNA replication.
Thus, while LCRs help increase genomic diversity, they can also be a double-edged sword with both beneficial and detrimental effects.
Evolutionary Impacts
The evolutionary impacts of segmental duplications are profound. These duplications can act as engines of genetic innovation. By providing extra copies of genes, they allow new gene functions to evolve without harming the original gene function in the organism. This process of gene duplication followed by divergence is a fundamental mechanism driving evolution. Over time, duplicated genes may acquire mutations that allow them to perform new functions or to be expressed in different tissues or times. This contributes to the diversity of life seen today.
However, the instability introduced by low-copy repeats can also lead to genetic disorders when they result in harmful rearrangements. Thus, segmental duplications are a double-edged sword, fostering both positive evolutionary change and potential genetic diseases.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

In Chapter 11 , we discussed three different types of sequences found in eukaryotic genomes: unique sequence DNA, moderately repetitive DNA, and highly repetitive DNA. Which of these sequences do you think would be most difficult to assemble into a complete genome sequence and why?

Some synthetic biologists have proposed creating an entirely new, free-living organism with a minimal genome, the smallest set of genes that allows for replication of the organism in a particular environment. This genome could be used to design and create, from scratch, novel organisms that might perform specific tasks, such as the breakdown of toxic materials in the environment. a. How might the minimal genome required for life be determined? b. What, if any, social and ethical concerns might be associated with the construction of an entirely new organism with a minimal genome?

How does proteomics differ from genomics?

A linear piece of DNA was broken into random, overlapping fragments, and each fragment was sequenced. The sequence of each fragment is shown below. Fragment \(1: 5^{\prime}-\mathrm{TAGTTAAAAC}-3^{\prime}\) Fragment \(2: 5^{\prime}-\mathrm{ACCGCAATACCCTAGTTAAA}-3^{\prime}\) Fragment \(3: 5^{\prime}-\mathrm{C C C T A G T T A A A A C}-3^{\prime}\) Fragment \(4: 5^{\prime}-\mathrm{ACCGCAATACCCTAGTT}-3^{\prime}\) Fragment \(5: 5^{\prime}-\mathrm{ACCGCAATACCCTAGTTAAA}-3^{\prime}\) Fragment \(6: 5^{\prime}-\mathrm{ATTTACCGCAAT}-3^{\prime}\) On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.

Describe several different methods for inferring the function of a gene by examining its DNA sequence.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.