/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 40 Much research has been devoted t... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Much research has been devoted to developing methods for detecting, sequencing, and measuring levels of RNA (see Chapters 23 and 13) within the cell. All RNA is transcribed from DNA, so what information does RNA provide that is not found in DNA sequences? Give at least three examples.

Short Answer

Expert verified
RNA provides expression patterns, structural roles, and splicing information not found in DNA sequences.

Step by step solution

01

Understanding the differences between RNA and DNA

RNA is a single-stranded molecule, while DNA is double-stranded. RNA is mainly involved in protein synthesis and regulation of gene expression, whereas DNA serves as a long-term storage of genetic information.
02

RNA as a messenger

The first key information RNA provides that DNA does not is the specific coding sequences that are actively being transcribed and translated into proteins. This shows which genes are being expressed in a particular cell or under certain conditions.
03

RNA structure and function diversity

The second example is the structural and functional diversity of RNA molecules, such as rRNA and tRNA, which are critical for protein synthesis but are not encoded directly by DNA sequences. These RNA types highlight the functional roles RNA plays in assembling and operating the cellular machinery.
04

RNA splicing and processing

Lastly, post-transcriptional modifications such as RNA splicing provide insight into the alternative splicing events that can lead to different protein products from a single DNA sequence. This RNA processing information cannot be directly inferred from DNA sequences alone.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

RNA structure
RNA, or ribonucleic acid, plays a crucial role in the cell. It's similar to DNA but with some differences that are important for its function. One of the main structural differences is that RNA is usually single-stranded, while DNA is double-stranded.
This single-stranded form allows RNA to fold into diverse 3D shapes. These shapes enable RNA to perform a wide range of functions, much more than just carrying genetic messages.
There are different types of RNA, each with its unique structure and role in the cell:
  • mRNA (messenger RNA): Carries the genetic code from DNA to the ribosomes, where proteins are synthesized.
  • tRNA (transfer RNA): Brings the correct amino acids to the ribosome during protein synthesis.
  • rRNA (ribosomal RNA): Makes up the ribosomes, which are the sites of protein synthesis.
These various structures underline RNA's importance in cellular functions, highlighting its versatility compared to DNA.
gene expression
Gene expression is the process by which information from a gene is used to synthesize a functional gene product, usually proteins. This process is vital for the proper functioning of cells and is primarily overseen by RNA.
When a gene in DNA needs to be expressed, it's first transcribed into mRNA, which carries the code that governs the production of proteins. This process is regulated and influenced by various RNA molecules to ensure that proteins are synthesized correctly and at the right time.
Gene expression can be divided into two main stages:
  • Transcription: The DNA sequence of a gene is copied into mRNA.
  • Translation: The mRNA is used as a template to build proteins, with the help of tRNA and rRNA.
Through these processes, RNA helps to translate genetic information into the proteins that are necessary for life. RNA, therefore, plays a vital role in determining how genes are expressed and function in different conditions.
RNA splicing
RNA splicing is a form of RNA processing that involves the removal of non-coding sequences from a precursor mRNA molecule. These non-coding sequences, known as introns, are removed so that the remaining coding sequences, known as exons, can be joined together to form a continuous coding sequence.
After transcription, the initial mRNA transcript, also called pre-mRNA, contains both introns and exons. Splicing is the key process that transforms pre-mRNA into mature mRNA, ready to be translated into a protein.
The significance of RNA splicing lies in its ability to enable alternative splicing. This process allows a single gene to code for multiple proteins, depending on which exons are included or excluded during splicing:
  • This variability results in different protein products from a single DNA blueprint.
  • Alternative splicing increases genetic diversity and functionality without the need for additional genes.
By editing the RNA molecule, splicing ensures that the genetic information is correct and adapted to specific cellular needs. This flexibility highlights the sophisticated level of gene regulation achieved through RNA processing.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Some synthetic biologists have proposed creating an entirely new, free-living organism with a minimal genome, the smallest set of genes that allows for replication of the organism in a particular environment. This genome could be used to design and create, from scratch, novel organisms that might perform specific tasks, such as the breakdown of toxic materials in the environment. a. How might the minimal genome required for life be determined? b. What, if any, social and ethical concerns might be associated with the construction of an entirely new organism with a minimal genome?

What is linkage disequilibrium? How does it result in haplotypes?

What might be some advantages of using CRISPR-Cas (see Chapter 19) for carrying out mutagenesis screens?

James Noonan and his colleagues (J. Noonan et al. 2005. Science 309:597- 599) set out to study the genome sequence of an extinct species of cave bear. They extracted DNA from 40,000 -year-old bones of a cave bear and used a metagenomic approach to isolate, identify, and sequence the cave-bear DNA. Why did they use a metagenomic approach when their objective was to sequence the genome of one species (the cave bear)?

A linear piece of DNA was broken into random, overlapping fragments, and each fragment was sequenced. The sequence of each fragment is shown below. Fragment \(1: 5^{\prime}-\mathrm{TAGTTAAAAC}-3^{\prime}\) Fragment \(2: 5^{\prime}-\mathrm{ACCGCAATACCCTAGTTAAA}-3^{\prime}\) Fragment \(3: 5^{\prime}-\mathrm{C C C T A G T T A A A A C}-3^{\prime}\) Fragment \(4: 5^{\prime}-\mathrm{ACCGCAATACCCTAGTT}-3^{\prime}\) Fragment \(5: 5^{\prime}-\mathrm{ACCGCAATACCCTAGTTAAA}-3^{\prime}\) Fragment \(6: 5^{\prime}-\mathrm{ATTTACCGCAAT}-3^{\prime}\) On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.