/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Genetics: A Conceptual Approach Chapter 20 - (Page 2) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 14

Explain how a reporter sequence can be used to provide information about the expression pattern of a gene.

Problem 16

What is the relation between genome size and gene number in prokaryotes?

Problem 17

What is horizontal gene transfer? How might it take place between different species of bacteria?

Problem 20

What is a segmental duplication?

Problem 21

The human genome does not encode substantially more protein domains than do invertebrate genomes, yet it encodes many more proteins. How are more proteins encoded when the number of domains does not differ substantially?

Problem 22

What is genomics, and how does structural genomics differ from functional genomics? What is comparative genomics?

Problem 23

How does proteomics differ from genomics?

Problem 27

The presence \((+)\) or absence \((-)\) of six sequences in each of five bacterial artificial chromosome (BAC) clones (A-E) is indicated in the following table. Using these markers, put the BAC clones in their correct order and indicate the locations of the numbered sequences within them.

Problem 28

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: \(5?–TAGTTAAAAC–3?\) Fragment 2: \(5?–ACCGCAATACCCTAGTTAAA–3?\) Fragment 3: \(5?–CCCTAGTTAAAAC–3?\) Fragment 4: \(5?–ACCGCAATACCCTAGTT–3?\) Fragment 5: \(5?–ACCGCAATACCCTAGTTAAA–3?\) Fragment 6: \(5?–ATTTACCGCAAT–3\) On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.

Problem 29

How does the density of genes found on chromosome 22 compare with the density of genes found on chromosome \(21,\) two similar-sized chromosomes? How does the number of genes on chromosome 22 compare with the number found on the Y chromosome? To answer these questions, go to www.ensembl.org. Under the heading Species, select Human. On the next page, click on View Karyotype. Pictures of the human chromosomes will appear. Click on chromosome 22 and select Chromosome Summary. You will be shown a picture of this chromosome and histograms of known genes (colored bars). The total numbers of coding (protein-encoding) genes, along with the chromosome length in base pairs, are given in the table at the bottom of the diagram. Write down the total length of the chromosome and the number of coding genes. Now go to chromosome 21 by selecting it from the Change Chromosome drop-down. Examine the total length and total number of protein-encoding genes for chromosome \(21 .\) Now do the same for the \(Y\) chromosome. Calculate the gene density (number of genes/length) for chromosomes \(22,21,\) and Y. a. Which chromosome has the highest density and greatest number of genes? Which has the fewest? b. Examine in more detail the genes at the tip of the short arm of the Y chromosome by clicking on the top bar in the histogram of genes. Jump to location view. A more detailed view will be shown. What known genes are found in this region? How many protein-encoding genes are there in this region?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks