/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Fundamentals of Microbiology Chapter 9 - (Page 2) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 11

Which of the following is true of transposons? A. They contain genes for bacterial metabolism. B. They are smaller than insertion sequences. C. They are examples of plasmids. D. They may have information for antibiotic resistance.

Problem 12

The Ames test is used to: A. identify potential human carcinogens. B. discover auxotrophic mutants. C. find pathogenic bacterial species. D. identify antibiotic resistant mutants.

Problem 13

Construct a concept map for Translation by using the following terms to fill in the concept map. Each term should be used only once. \- Amino acid \- Chain elongation \- Chain initiation \- Chain termination \- Large subunit \- mRNA \- Polypeptide \- Ribosome \- Sense codons \- Small subunit \- Start codon \- Stop codon \- Termination factors \- tRNAs

Problem 15

If a DNA sequence contains \(30 \%\) thymine nucleotides, what percentage of this sequence is composed of adenine, guanine, and cytosine nucleotides?

Problem 17

Use the base sequence to answer the following questions about mutations. TACACGATGGTTTTGAAGTTACGTATT A. Is the sequence above a single strand of DNA or RNA? Explain. B. Using the sequence above, show the translation result if a mutation results in a \(\mathrm{C}\) replacing the \(\mathrm{T}\) at base 12 from the left end of the sequence. Is this an example of a silent, missense, or nonsense mutation? C. Using the sequence above, show the translation result if a mutation results in an \(\mathrm{A}\) inserted between the \(\mathrm{T}\) (base 12 ) and the \(\mathrm{T}\) (base 13) from the left end of the sequence. Is this an example of a silent, missense, or nonsense mutation?

Problem 18

A chemical is tested with the Ames test to see if the chemical is mutagenic, and therefore possibly a tumor-causing chemical in humans. On the test plate containing the chemical, no his \(^{+}\) colonies are seen near the central well. However, many colonies are growing some distance from the well. If these colonies truly represent his \(^{+}\)colonies, why are there no colonies closer to the central well?

Problem 19

Many viruses have double-stranded DNA as their genetic information, whereas many others have single-stranded RNA as the genetic material. Which group of viruses do you believe is more likely to efficiently repair its genetic material? Explain.

Problem 20

Some scientists suggest that mutation is the single most important event in evolution. Do you agree? Why or why not?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks