/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 17 Use the base sequence to answer ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Use the base sequence to answer the following questions about mutations. TACACGATGGTTTTGAAGTTACGTATT A. Is the sequence above a single strand of DNA or RNA? Explain. B. Using the sequence above, show the translation result if a mutation results in a \(\mathrm{C}\) replacing the \(\mathrm{T}\) at base 12 from the left end of the sequence. Is this an example of a silent, missense, or nonsense mutation? C. Using the sequence above, show the translation result if a mutation results in an \(\mathrm{A}\) inserted between the \(\mathrm{T}\) (base 12 ) and the \(\mathrm{T}\) (base 13) from the left end of the sequence. Is this an example of a silent, missense, or nonsense mutation?

Short Answer

Expert verified
A: It's a DNA sequence. B: Missense mutation. C: Nonsense mutation.

Step by step solution

01

Identify the type of nucleic acid

The base sequence provided is TACACGATGGTTTTGAAGTTACGTATT. DNA is composed of the bases Adenine (A), Thymine (T), Cytosine (C), and Guanine (G), while RNA uses Uracil (U) instead of Thymine. Since the sequence contains Thymine (T), it is a DNA sequence.
02

Analyze mutation by substituting C for T at base 12

The original sequence is TACACGATGGTTTTGAAGTTACGTATT. Replace the 12th base T with C, which changes the sequence to TACACGATGGTCCTGAAGTTACGTATT. Now, convert the sequence to mRNA by substituting U for T: AUGUGCUACCAGAAUUCGAUGCAGUAA. Divide the mRNA into codons: AUG-UGC-UAC-CAG-AAU-UCG-AUG-CAG-UA-A....
03

Translate mutated mRNA sequence and classify mutation

Translate each codon. Referencing a codon table, the translation yields: MET-CYS-TYR-GLN-ASN-SER-MET-GLN. The original translation without the mutation was MET-CYS-TYR-VAL-PHE-GLU-VAL. The amino acid GLN was translated instead of PHE, indicating a missense mutation.
04

Analyze mutation by inserting A between T at base 12 and T at base 13

The original sequence is TACACGATGGTTTTGAAGTTACGTATT. Insert A between the 12th and 13th bases, creating TACACGATGGTATTTGAAGTTACGTATT. Generate mRNA: AUGUGCUACCUAAAUCGAUGCAGUAUU. Divide the mRNA into codons: AUG-UGC-UAC-CUA-AAU-CGA-UGC-AGU-AU-U....
05

Translate mutated mRNA sequence with insertion and classify mutation

Translate each codon using a codon table: MET-CYS-TYR-GLU-ASN-ARG-END.... The insertion caused a frame shift, significantly altering the amino acid sequence and resulting in a premature stop codon. This is a nonsense mutation.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA Sequence
The DNA sequence is fundamental to understanding genetic mutations. DNA, short for deoxyribonucleic acid, is like a blueprint for living organisms. It is made up of a series of nucleotides, which are small molecules represented as the letters A, T, C, and G. This sequence of letters forms what we often refer to as the genetic code. Any change in this sequence can lead to genetic mutations.
  • Adenine (A) pairs with Thymine (T)
  • Cytosine (C) pairs with Guanine (G)
In the original exercise, the sequence given "TACACGATGGTTTTGAAGTTACGTATT" signifies a DNA strand, as evidenced by the presence of Thymine (T). In contrast, RNA would contain Uracil (U) instead. Changes or mutations in sequences like this can have significant effects on downstream cellular processes. It's crucial to understand the type and location of a mutation to predict its impact.
RNA Transcription
RNA transcription is the process of creating a complementary RNA strand from a DNA template. This is essential for protein synthesis, as RNA serves as the intermediary between the genetic information stored in DNA and the protein-building machinery of the cell. During transcription, RNA polymerase reads the DNA sequence and builds a strand of mRNA by replacing T with U. For the exercise sequence "TACACGATGGTTTTGAAGTTACGTATT", during transcription, the resulting mRNA sequence would be "AUGUGCUACCAGAAUUCGAUGCAGUAA", after making substitutions:
  • Thymine (T) becomes Uracil (U)
  • Remaining nucleotides are transcribed directly (A to A, C to C, G to G)
This mRNA strand is now ready to be translated into a protein, showing how even a single nucleotide change during transcription can alter this process dramatically.
Protein Synthesis
Protein synthesis is the cellular process of building proteins, which are crucial for the structure and function of all living organisms. This process occurs in two main stages: transcription and translation. During translation, the mRNA sequence is read in sets of three nucleotides called codons, each representing a specific amino acid. A change in the DNA sequence can lead to different outcomes based on the nature of the mutation: silent, missense, or nonsense.
  • Silent mutations: No change in the resulting protein.
  • Missense mutations: Change one amino acid in the protein, potentially altering function.
  • Nonsense mutations: Introduce a premature stop codon, leading to incomplete proteins.
For instance, in our exercise, substituting C for T at base 12 resulted in a missense mutation because it changed one amino acid without stopping the protein's synthesis. However, inserting an A between bases 12 and 13 led to a frame shift and nonsense mutation, as the reading frame altered the entire sequence, culminating in an early stop codon. This highlights the profound impact even small mutations can have on protein synthesis.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.