/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 15 If a DNA sequence contains \(30 ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

If a DNA sequence contains \(30 \%\) thymine nucleotides, what percentage of this sequence is composed of adenine, guanine, and cytosine nucleotides?

Short Answer

Expert verified
The sequence is composed of 30% adenine, 20% guanine, and 20% cytosine.

Step by step solution

01

Understanding DNA Complementary Base Pairing

In DNA, there are four types of nucleotides: adenine (A), thymine (T), guanine (G), and cytosine (C). Adenine pairs with thymine, and guanine pairs with cytosine. Therefore, in a DNA molecule, the amount of adenine is equal to the amount of thymine ( A = T ), and the amount of guanine is equal to the amount of cytosine ( G = C ).
02

Calculating Percentage of Adenine

Since adenine pairs with thymine and the sequence contains 30% thymine, the sequence must also contain 30% adenine. This is because the amounts of adenine and thymine are equal in a DNA sequence.
03

Calculating Total Percentage of Adenine and Thymine

Add the percentage of adenine and thymine together: A + T = 30 ext{%} + 30 ext{%} = 60 ext{%}.
04

Calculating Percentage of Guanine and Cytosine

Since adenine and thymine together make up 60% of the sequence, the remaining percentage must be guanine and cytosine. Thus, G + C = 100 ext{%} - 60 ext{%} = 40 ext{%}. Since guanine pairs with cytosine, G = C, which means each of them is 20%.
05

Summarizing the Nucleotide Composition

The DNA sequence is composed of 30% adenine, 30% thymine, 20% guanine, and 20% cytosine.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Base Pairing
DNA, or deoxyribonucleic acid, is the molecule that carries our genetic instructions. It has a unique structure formed by four types of nucleotides. These nucleotides are adenine (A), thymine (T), guanine (G), and cytosine (C). In the DNA molecule, these nucleotides adhere to a rule known as base pairing. This means adenine always pairs with thymine, and guanine always pairs with cytosine.

The reason for this specific base pairing is due to the molecular structure. Adenine and thymine form two hydrogen bonds between them, making their pairing stable. Guanine and cytosine make three hydrogen bonds, which ensures their strong connection as well. This predictable pairing is crucial as it allows the DNA strands to replicate accurately, preserving the genetic information during cell division.
  • Adenine (A) pairs with Thymine (T)
  • Guanine (G) pairs with Cytosine (C)
Adenine Thymine Guanine Cytosine Percentages
In a DNA sequence, the percentages of nucleotides are dictated by base pairing rules. If you know the percentage of one nucleotide, you can calculate the percentages of the others. This exercise illustrates that if we have 30% thymine, we must also have 30% adenine. This is because A and T are directly paired in the DNA sequence.

To find the adenine percentage, simply use the thymine percentage, which is provided in the problem. The percentage of adenine will be equal as adenine pairs one-to-one with thymine. Similarly, since we know adenine and thymine make up 60% of the total nucleotides together, the remaining 40% will be split evenly between guanine and cytosine. So, both guanine and cytosine will each be 20% of the DNA sequence.
  • Adenine (A) = 30%
  • Thymine (T) = 30%
  • Guanine (G) = 20%
  • Cytosine (C) = 20%
DNA Sequence Percentages
The DNA sequence is made up of four nucleotides, and the total percentage of these must always equal 100%. Understanding the individual percentages of adenine, thymine, guanine, and cytosine helps us to comprehend the entire composition of the DNA sequence. In this scenario, knowing that thymine is 30%, we can easily deduce that adenine must also be 30%, due to the base pairing rule.

Once we have adenine and thymine percentages calculated, we can figure out the percentages for guanine and cytosine, which must sum up to make the rest of the DNA sequence. Since adenine and thymine together total 60%, guanine and cytosine will together make up the remaining 40%, equally split. This helps us ensure the calculations make sense when assessing DNA sequences with partial nucleotide information. It also provides a clear picture on how evenly the DNA structure is balanced.
  • Total percentage of A + T = 60%
  • Total percentage of G + C = 40%
  • Complete DNA sequence = 100%

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Use the base sequence to answer the following questions about mutations. TACACGATGGTTTTGAAGTTACGTATT A. Is the sequence above a single strand of DNA or RNA? Explain. B. Using the sequence above, show the translation result if a mutation results in a \(\mathrm{C}\) replacing the \(\mathrm{T}\) at base 12 from the left end of the sequence. Is this an example of a silent, missense, or nonsense mutation? C. Using the sequence above, show the translation result if a mutation results in an \(\mathrm{A}\) inserted between the \(\mathrm{T}\) (base 12 ) and the \(\mathrm{T}\) (base 13) from the left end of the sequence. Is this an example of a silent, missense, or nonsense mutation?

Some scientists suggest that mutation is the single most important event in evolution. Do you agree? Why or why not?

A chemical is tested with the Ames test to see if the chemical is mutagenic, and therefore possibly a tumor-causing chemical in humans. On the test plate containing the chemical, no his \(^{+}\) colonies are seen near the central well. However, many colonies are growing some distance from the well. If these colonies truly represent his \(^{+}\)colonies, why are there no colonies closer to the central well?

Match each statement at the left with its term (A-D) at the right A. Deletion/insertion B. Missense C. Nonsense D. Silent _______ The mutation that produces a polypeptide fro an mRNA with a premature stop codon.

Which of the following is true of transposons? A. They contain genes for bacterial metabolism. B. They are smaller than insertion sequences. C. They are examples of plasmids. D. They may have information for antibiotic resistance.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.