/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Q5CP Which codons serve as punctuatio... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 27: Q5CP (page 988)

Which codons serve as punctuation signals?

Short Answer

Expert verified

The initiation codons and the stop codons serve as punctuation signals.

Step by step solution

01

Initiation codon

AUG or sometimes GUG serves as the initiation codon, which helps initiate translation to form a polypeptide chain. There are no gaps between the reading frame of nucleotides in the mRNA. Therefore, the start can be considered as punctuation.

02

Stop codon

There are three stop codons, also known as non-sense codons: UGA, UAG, and UAA. They don鈥檛 code for any amino acid and signals for the termination of protein synthesis. Thus, it can be considered as punctuation, a full stop.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

What mechanism ensures that the ribosome translocates by exactly three nucleotides?

Explain the significance of the observation that peptides such as fMet-Leu-Phe "activate" the phagocytotic (particle-engulfing) functions of mammalian leukocytes (white blood cells).

Describe the similarities and differences between prokaryotic and eukaryotic ribosomes.

Summarize the role of GTP hydrolysis in promoting the efficiency of translation initiation, decoding, translocation, and chain termination.

The flu virus maximizes the use of its limited (13.5 kB) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a different C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.

鈥� GAUUCCUUUCGUCAGUCCGAGA 鈥�
See all solutions

Recommended explanations on Biology Textbooks

Biological Organisms

Read Explanation

Reproduction

Read Explanation

Ecology

Read Explanation

Biological Processes

Read Explanation

Biological Molecules

Read Explanation

Microbiology

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.