Chapter 27: Q22P (page 1030)
The flu virus maximizes the use of its limited (13.5 kB) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a different C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
鈥 GAUUCCUUUCGUCAGUCCGAGA 鈥
Short Answer
The normal polypeptide sequence of the given codon will be:
Asp-Ser-Phe-Arg-Gln-Ser-Glu
The sequence with the frameshift will be:
Asp-Ser-Phe-Val-Ser-Pro-Arg