Chapter 3: Q7CP (page 50)
List the structural differences between DNA and RNA.
Short Answer
The DNA has the major and minor grooves while the RNA does not have any special grooves.
/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none}
Learning Materials
Features
Discover
Chapter 3: Q7CP (page 50)
List the structural differences between DNA and RNA.
The DNA has the major and minor grooves while the RNA does not have any special grooves.
All the tools & learning materials you need for study success - in one app.
Get started for free
Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR.
ATAGGCATAGGCCCATATGGCATAAGGCTTTATAATATGCGATAGGCGCTGGTCAG
Question: Compare the properties of cloning vectors such as pUC18, bacteriophage λ, and BACs
Kinases are enzymes that transfer a phosphoryl group from a nucleoside triphosphate. Which of the following are valid kinase-catalyzed reactions?
(a)
(b)
Describe the possible outcome of a PCR experiment in which (a) one of the primers is inadvertently omitted from the reaction mixture and (b) one of the primers is complementary to several sites in the starting DNA sample.
List all the components and explain their purpose in the reaction mixture used for the dideoxy DNA sequencing method.
What do you think about this solution?
We value your feedback to improve our textbook solutions.