/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Biology Chapter 15 - (Page 2) [step by step] 9781947172517 | 91Ó°ÊÓ

91Ó°ÊÓ

20.question

Page 392

Discuss how degeneracy of the genetic code makes cells more robust to mutations.

21.question

Page 392

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?

22.question

Page 392

If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?

24.question

Page 392

A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

25.question

Page 392

A scientist observes that a cell has an RNA polymerase deficiency that prevents it from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect ?

3.question

Page 391

Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis?

Tetracycline would directly affect:

a. tRNA binding to the ribosome

b. ribosome assembly

c. growth of the protein chain

Chloramphenicol would directly affect

a. tRNA binding to the ribosome

b. ribosome assembly

c. growth of the protein chain

4.question

Page 391

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this?

a. complementarity

b. nonsense codons

c. universality

d. degeneracy

5.question

Page 391

How many nucleotides are in 12 mRNA codons?

a. 12

b. 24

c. 36

d. 48

8.question

Page 391

The -10 and -35 regions of prokaryotic promoters are called consensus sequences because ________.

a. they are identical in all bacterial species b. they are similar in all bacterial species

c. they exist in all organisms

d. they have the same function in all organisms

9.question

Page 391

Three different bacteria species have the following consensus sequences upstream of a conserved gene.

Table 15.2 Order the bacteria from most to least efficient initiation of gene transcription. a. A > B > C b. B > C > A c. C > B > A d. A > C > B

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks