/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for The Molecules of Life: Physical and Chemical Principles Chapter 2 - (Page 2) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 15

List at least three physical features that distinguish Aand Z-form DNA.

Problem 16

In water, why is base stacking relatively more important than hydrogen bonding to forming a DNA double helix?

Problem 20

Which of the following DNA sequences is most likely to adopt the Z-form? Why? a. GCGCGCGCATATGCGCGCGCC b. AGAGAGCTCTCTCTCTA.A.A.AT

Problem 21

Consider a relaxed, closed-circular DNA plasmid that has 1040 base pairs with writhe \(=0\). An intercalator is added, such that there is one intercalator per 104 base pairs. The effect of the intercalator is to cause the twist between the base pairs that flank it to be reduced to zero. Will the resulting intercalator-bound DNA be positively or negatively supercoiled?

Problem 22

The structure of the large ribosomal subunit from Haloarcula marismortui (PDB code: 1FFK) has been solved by x-ray crystallography. The \(23 S\) RNA contains 2922 nucleotides (758 A, 889 G, 739 C, and 536 U). a. Assuming a random distribution of nucleotides, how many four-mer sequences with the sequence \(\mathrm{G}-\mathrm{N}\) (any base)-R (purine)-A are possible? b. There are actually 21 GNRA tetraloops in the structure. What percentage of possible GNRA sequences actually formed tetraloops in the structure?

Problem 23

A bacterial DNA polymerase moves at approximately 1000 base pairs per second when replicating DNA. The polymerase holoenzyme is approximately \(110 \AA\) long. By what multiple of its length does the polymerase move forward along the axis of the DNA double helix in 3 seconds? Assume the DNA stays fixed and ignore the rotational component of the motion of the polymerase along the DNA.

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks