/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 20 Which of the following DNA seque... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Which of the following DNA sequences is most likely to adopt the Z-form? Why? a. GCGCGCGCATATGCGCGCGCC b. AGAGAGCTCTCTCTCTA.A.A.AT

Short Answer

Expert verified
Sequence A (GCGCGCGCATATGCGCGCGCC) is most likely to adopt the Z-form due to its alternating GC base pairs.

Step by step solution

01

Understand DNA Forms

DNA can exist in different forms, primarily A, B, and Z. The Z-form is a left-handed helix and is often adopted by sequences rich in alternating purines and pyrimidines, typically GC repeats.
02

Analyze Option A

The sequence in option A, GCGCGCGCATATGCGCGCGCC, has a pattern of alternating GC elements, specifically G-C repeats, which are favorable for adopting the Z-form of DNA.
03

Analyze Option B

The sequence in option B, AGAGAGCTCTCTCTCTA.A.A.AT, contains mostly AT sequences and does not have the long stretches of alternating G-C base pairs needed for the Z-form.
04

Determine the Most Likely Z-form Sequence

Based on the presence of alternating GC base pairs, sequence A is most likely to adopt the Z-form due to its consistent GC repetition pattern.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Z-DNA
Z-DNA is a fascinating form of DNA that differs significantly from the more commonly known B-DNA structure. While B-DNA is a right-handed helix, Z-DNA twists in the opposite direction, making it a left-handed helical structure. This unusual form of DNA has unique physical properties and specific requirements for its formation.
Z-DNA is often associated with sequences that contain alternating purines and pyrimidines, with a high occurrence of guanine (G) and cytosine (C) bases. These GC-rich sequences create a zigzag backbone in the DNA helix, which contributes to its left-handed orientation. Z-DNA may play a role in gene regulation and expression due to its structural properties and its potential to form and stabilize under physiological conditions.
Although its occurrence in living cells is less frequent compared to other DNA forms, Z-DNA's distinct structural characteristics make it an intriguing subject of study in the field of molecular biology.
GC-rich sequences
GC-rich sequences refer to segments of DNA that have a high concentration of guanine (G) and cytosine (C) base pairs. These sequences are particularly stable due to the triple hydrogen bonding between G and C, compared to the double hydrogen bonds between adenine (A) and thymine (T).
The stability provided by GC-rich regions is crucial in various biological processes. For instance, these regions are often found in the promoter areas of genes, where gene expression is initiated. Their stability ensures the integrity of these critical regions during DNA replication and repair.
In terms of DNA form, GC-rich sequences are more likely to adopt the Z-DNA conformation, as seen in their ability to create the alternating GC pattern necessary for the formation of this left-handed helical structure. This is evident in the example sequence GCGCGCGC found in the original exercise, which favors the Z-form due to its repetition of GC base pairs.
DNA forms
DNA can take on several structural forms, primarily the A, B, and Z conformations. While B-DNA is the most prevalent form found in nature, characterized by a right-handed helix, there are instances where DNA can adopt other structures like A-DNA and Z-DNA, under specific conditions.
A-DNA is a right-handed helix like B-DNA but is shorter and more compact. It is typically found in dehydrated samples of DNA or double-stranded RNA. On the other hand, Z-DNA is a left-handed helix, as previously mentioned, which differs significantly in its physical arrangement of base pairs compared to A-DNA and B-DNA.
Understanding these different forms of DNA is essential in the study of genetic materials, as each form can influence the biological roles DNA plays, such as accessibility for replication, transcription, or interaction with proteins. These various forms help scientists comprehend how DNA's structure impacts its function within cells.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.