/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Holt: Modern Chemistry Chapter 23 - (Page 2) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 26

What are the main differences between DNA and RNA?

Problem 27

Describe the similarities and differences between the three kinds of RNA molecules.

Problem 28

What is a ribosome? What is the function of a ribosome in a cell?

Problem 29

The following sequence of bases might be found on the gene that codes for oxytocin, the human pituitary hormone: TACACAATGTAAGTTTTGACGGGGGACCCTATC a. What is the base sequence of the complementarystrand of DNA? b. What is the base sequence that would occur on a strand of mRNA transcribed from the oxytocin DNA sequence?

Problem 30

Name the four main elements that make up compounds found in living organisms.

Problem 31

In each of the following groups, one of the items does not belong in the group. Identify the odd item in the group and explain why it is different. Explain how the other items are related. a. glycogen, starch, fructose, and cellulose b. amino acids, dipeptides, polypeptides, and proteins c. fats, oils, and fatty acids d. cytosine, adenine, and uracil

Problem 32

What is the human body’s storage form of each of the following? a. glucose b. lipids c. protein

Problem 33

Is each of the following statements about proteins and triglycerides true or false? a. Both contain the amide functional group. b. Both are a part of a major class of biochemical molecules. c. Both hydrolyze in order to enter the metabolic pathway in humans.

Problem 35

Both celery and potato chips are composed of molecules that are polymers of glucose. Explain why celery is a good snack for people on a diet while potato chips are not.

Problem 36

Carbohydrates, fats, and proteins can produce energy for an organism. a. Which class of substances most rapidly provides energy? b. Which class can be used as a building material in the human body? c. Which is the most efficient as an energy storage system?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks