/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 30 Name the four main elements that... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 23: Problem 30

Name the four main elements that make up compounds found in living organisms.

Short Answer

Expert verified
Carbon (C), Hydrogen (H), Oxygen (O), and Nitrogen (N).

Step by step solution

01

Identify Essential Elements

Living organisms are made up of various compounds, and there are four main elements that form these compounds.
02

List the Elements

The four main elements that are essential for life and make up the compounds in living organisms are Carbon (C), Hydrogen (H), Oxygen (O), and Nitrogen (N).

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Carbon
Carbon is one of the fundamental building blocks of life. It's unique in that it can form four stable covalent bonds with other atoms, including itself. This allows carbon to form an immense variety of complex molecules, which are critical for life.
Carbon-based compounds are also known as organic compounds. These include everything from sugars (glucose) to complex molecules like DNA and proteins. Here are some key points about carbon in biological systems:
  • It's present in all known life forms.
  • It forms the backbone of organic molecules.
  • It participates in energy storage and transfer (e.g., ATP).
  • It's key to metabolic processes.
The versatility of carbon is what allows for the diversity of organic life forms and molecules.
Hydrogen
Hydrogen is the most abundant element in the universe and plays a crucial role in living organisms. In biological systems, hydrogen is primarily involved in the formation of water (H鈧侽), which is vital for all known forms of life.
Water is essential for various biochemical processes such as solvent capabilities, temperature regulation, and nutrient transport.
Additionally, hydrogen atoms also participate in:
  • Forming bonds with carbon and oxygen to create carbohydrates, proteins, and fats.
  • Involvement in cellular respiration, which generates ATP.
  • Maintaining pH balance in cell fluids.
Without hydrogen, life as we know it would not exist. It's indispensable for the structure and function of molecules that sustain life.
Oxygen
Oxygen is another essential element for life, most famously known for its role in respiration. It is a part of water (H鈧侽) and is crucial for cellular respiration, a process in which cells produce energy.
In respiration, oxygen acts as an electron acceptor in the electron transport chain, helping to produce ATP, the energy currency of cells.
Oxygen also plays a part in:
  • Formation of organic molecules with carbon and hydrogen.
  • Being a key component in metabolism and energy production.
  • Regulating blood pH through hemoglobin in red blood cells.
Because of its high reactivity, oxygen is involved in many biochemical reactions, making it indispensable for most life forms.
Nitrogen
Nitrogen is a critical element in living organisms, key for the formation of amino acids, which are the building blocks of proteins. Proteins are essential for cell structure, function, and regulation.
Nitrogen is also a component of nucleic acids like DNA and RNA, which are crucial for genetic information storage and transfer.
Other roles of nitrogen include:
  • Participating in nitrogen cycles in nature (nitrogen fixation and denitrification).
  • Being a part of coenzymes and vitamins.
  • Forming nitrogenous bases that are fundamental for DNA and RNA.
The presence of nitrogen is fundamental for the synthesis of many biomolecules that support life and enable growth and reproduction in living organisms.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

How many different tripeptides can be formed from two molecules of glycine and one molecule of cysteine? Write all the structures by using the three-letter codes Gly and Cys.

Inferring Relationships Explain how a similar reaction forms three kinds of biological polymers: polysaccharides, polypeptides, and nucleic acids.

What are the three components of a nucleotide?

In each of the following groups, one of the items does not belong in the group. Identify the odd item in the group and explain why it is different. Explain how the other items are related. a. glycogen, starch, fructose, and cellulose b. amino acids, dipeptides, polypeptides, and proteins c. fats, oils, and fatty acids d. cytosine, adenine, and uracil

The following sequence of bases might be found on the gene that codes for oxytocin, the human pituitary hormone: TACACAATGTAAGTTTTGACGGGGGACCCTATC a. What is the base sequence of the complementarystrand of DNA? b. What is the base sequence that would occur on a strand of mRNA transcribed from the oxytocin DNA sequence?
See all solutions

Recommended explanations on Chemistry Textbooks

Physical Chemistry

Read Explanation

Chemical Reactions

Read Explanation

Kinetics

Read Explanation

Chemistry Branches

Read Explanation

Making Measurements

Read Explanation

Chemical Analysis

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.