/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for General Chemistry Chapter 25 - (Page 3) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 35

Write a structural formula for the nucleotide adenosine-5'-monophosphate.

Problem 36

Write a structural formula for the nucleotide deoxyadenosine- \(5^{\prime}\) -monophosphate.

Problem 37

How many hydrogen bonds link a guanine-cytosine base pair? an adenine-uracil base pair? Would you expect any difference in strength between guanine- cytosine bonding and adenine-uracil bonding? Explain.

Problem 38

How many hydrogen bonds link an adenine-thymine base pair? Would there be any difference in strength between adenine-thymine bonding and adenine-uracil bonding? between adenine-thymine and cytosine-guanine bonding? Explain.

Problem 39

If a codon consists of two nucleotides, how many codons would be possible? Would this be a workable code for the purpose of protein synthesis?

Problem 40

If a codon consists of four nucleotides, how many codons would be possible? Would this be workable as an amino-acid code?

Problem 41

Nucleic acids can be denatured by heat, as proteins can. What bonds are broken when a DNA molecule is denatured? Would DNA of greater percent composition of guanine and cytosine denature more or less readily than DNA of greater percent composition of adenine and thymine?

Problem 42

Would RNA of a certain percent composition of guanine and cytosine denature more or less readily than RNA with a lower percent of guanine and cytosine? Why?

Problem 43

Consulting Table \(25.3\), write the amino-acid sequence resulting from left-to- right translation of the messenger RNA sequence GGAUCCCGCUUUGGGCUGAAAUAG

Problem 45

List the codons to which the following anticodons would form base pairs: Anticodon: GAC UGA GGG ACC Codon:

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks