Chapter 25: Problem 43
Consulting Table \(25.3\), write the amino-acid sequence resulting from left-to- right translation of the messenger RNA sequence GGAUCCCGCUUUGGGCUGAAAUAG
Short Answer
Expert verified
Gly-Ser-Arg-Phe-Gly-Leu-Lys
Step by step solution
01
Understand the Question
We are given an mRNA sequence and we need to translate it into an amino acid sequence using the genetic code table. Translation involves reading the mRNA sequence in triplets, known as codons, and converting each codon into its corresponding amino acid.
02
Divide the mRNA Sequence into Codons
The mRNA sequence `GGAUCCCGCUUUGGGCUGAAAUAG` should be divided into codons, which are groups of three nucleotides. This sequence can be grouped as follows: `GGA`, `UCC`, `CGC`, `UUU`, `GGG`, `CUG`, `AAA`, `UAG`.
03
Translate Codons to Amino Acids
Using a genetic code table, we convert each codon to its corresponding amino acid.
- `GGA` corresponds to Gly (Glycine)
- `UCC` corresponds to Ser (Serine)
- `CGC` corresponds to Arg (Arginine)
- `UUU` corresponds to Phe (Phenylalanine)
- `GGG` corresponds to Gly (Glycine)
- `CUG` corresponds to Leu (Leucine)
- `AAA` corresponds to Lys (Lysine)
- `UAG` is a stop codon and does not code for an amino acid.
04
Write Down the Amino Acid Sequence
Assembling the amino acids from the translated codons, the sequence is Gly-Ser-Arg-Phe-Gly-Leu-Lys. The translation stops at the stop codon, `UAG`, which does not encode an amino acid.
Unlock Step-by-Step Solutions & Ace Your Exams!
-
Full Textbook Solutions
Get detailed explanations and key concepts
-
Unlimited Al creation
Al flashcards, explanations, exams and more...
-
Ads-free access
To over 500 millions flashcards
-
Money-back guarantee
We refund you if you fail your exam.
Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
Genetic Code
The genetic code is the set of rules that defines how the sequence of nucleotides in messenger RNA (mRNA) is translated into a sequence of amino acids in a protein. This code is universal, meaning it is the same for almost all organisms on Earth. Each three-nucleotide set, known as a codon, corresponds to a specific amino acid. These sets ensure that the correct proteins are synthesized, maintaining the proper functioning of cells.
- Universal: Used by almost all living organisms.
- Unambiguous: Each codon codes for only one amino acid.
- Redundant: Multiple codons can code for the same amino acid.
Codons
Codons are sequences of three nucleotides in mRNA that specify which amino acid will be added next during protein synthesis. They are essential components of the genetic code. During translation, ribosomes read these codons and use them to assemble proteins from amino acids.
- Triplets: Composed of three nucleotides.
- Specific: Each codon corresponds to a single amino acid or a start/stop signal.
- Interpreted by: tRNA molecules that match codons with their corresponding amino acids.
Amino Acids Sequence
An amino acids sequence is the particular order in which amino acids are linked together to form a protein. This sequence determines the structure and function of the resulting protein since it influences how the protein folds and interacts with other molecules. The sequence is dictated by the mRNA template during translation.
- Determines protein structure: Influences folding and shape.
- Impacts protein function: Essential for biological activity.
- Created during: Protein synthesis process guided by mRNA.
Stop Codon
A stop codon is a specific sequence of three nucleotides in mRNA that signals the termination of protein synthesis. It is important because it marks the point at which translation should end, ensuring that proteins are synthesized to the correct length.
- Signal: Instructs the ribosome to stop translation.
- Examples: `UAG`, `UAA`, and `UGA` are common stop codons.
- Does not code for an amino acid: Unlike other codons, stop codons do not correspond to amino acids.
Protein Synthesis
Protein synthesis is the process by which cells construct proteins, the essential building blocks for cellular function and structure. This process involves two main stages: transcription and translation.
- Transcription: DNA is copied into mRNA.
- Translation: mRNA is used to assemble proteins at ribosomes.
- Role of ribosomes: Catalyze the formation of peptide bonds between amino acids.