/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Essential Biochemistry Chapter 21 - (Page 4) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 55

A poly(A)-binding protein (PABP) has an affinity for RNA molecules with poly(A) tails. What is the effect of adding PABP to a cell-free system containing mRNA and RNases?

Problem 56

The only mRNA transcripts that lack poly(A) tails are those encoding histones. Why do these mRNA transcripts not require poly(A) tails?

Problem 58

Genetic engineers must modify eukaryotic genes so that they can be expressed in bacterial host cells. Explain why the DNA from a eukaryotic gene cannot be placed directly into the bacteria but is first transcribed to mRNA and then reverse-transcribed back to cDNA.

Problem 59

Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than about \(65 \mathrm{bp}\). What are some reasons for this minimum intron size?

Problem 60

Introns are removed co-transcriptionally rather than posttranscriptionally. Why is this a good cellular strategy?

Problem 61

A portion of the gene for the \(\beta\) chain of hemoglobin is shown below. The sequence on the left includes the \(5^{\prime}\) splice site and the sequence on the right includes the \(3^{\prime}\) splice site for the intron between exons 1 and 2 . Identify the \(5^{\prime}\) splice site and the \(3^{\prime}\) splice site. .. CCCTGGGCAGGTTGGTA ... \(\ldots\) TTTCCCACCCTTAGGCTGCT ...

Problem 62

The hemoglobin \(\beta\) chain gene contains three exons, so two introns must be removed from the primary mRNA transcript (see Problem 61). What types of mutations would result in splicing errors? How would the mutations affect the protein translated from the improperly spliced mRNA?

Problem 64

Explain why the vast majority of nucleic acids with catalytic activity are RNA rather than DNA.

Problem 67

Biochemistry textbooks published a few decades ago often used the phrase "one gene, one protein." Why is this phrase no longer accurate?

Problem 68

Based on the information in this chapter, give at least three reasons why a silent mutation in a gene (that is, a mutation that does not alter the amino acid sequence of the encoded protein) could decrease the amount of protein expressed.

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks