/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 2 Find an open-reading frame in th... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Find an open-reading frame in the following sequence. ACTTAGCCCCGTAAGCTCGATT

Short Answer

Expert verified
No complete ORF starts with ATG in the sequence.

Step by step solution

01

Understand the Sequence

The sequence provided is ACTTAGCCCCGTAAGCTCGATT. An open-reading frame (ORF) in a DNA sequence is a continuous sequence of nucleotides that can potentially code for a peptide or protein, and is flanked by a start and stop codon. In DNA, the start codon is typically ATG, and stop codons are TAA, TAG, or TGA.
02

Identify the Start Codon

Search the sequence for the presence of the start codon ATG. In the sequence ACTTAGCCCCGTAAGCTCGATT, the ATG codon does not appear. Without the start codon, typical ORF prediction within this sequence does not feature a conventional starting point.
03

Identify Stop Codons

Even if there's no start codon, search for any stop codons (TAA, TAG, TGA) in the reading frames. In frame 1 (starting at position 1), the stop codon TAG is present at positions 3 to 5. Similarly, a TAA is present at positions 10 to 12 in frame 2 starting from C, and a TAG at positions 9 to 11 starting from T in frame 3.
04

Analyze the Frames

Though traditional ORFs begin with ATG, if requested to identify any potential ORFs bypassing the missing ATG, one might start from the 1st nucleotide and go until a stop codon with consideration that standard ORF finding would be inappropriate until ATG is first encountered. Without the initial ATG codon, named conventional ORFs might not be possible in provided sequence.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Start Codon
To understand the concept of a start codon, we need to know that it is essentially a signal to begin protein synthesis in cells. In most organisms, the start codon is represented by the nucleotide triplet "ATG". This triplet codes for the amino acid methionine and sets the reading frame for the translation process. During this process, ribosomes identify the start codon as the point to start translating the mRNA into a protein. It is vital for identifying the beginning of an open reading frame (ORF). Without a start codon, the ribosomes won't know where to start, and protein synthesis might not occur correctly. However, not all sequences contain this critical ATG, as seen in the provided sequence. In this case, predicting traditional ORFs becomes more challenging.
Stop Codon
A stop codon signifies where the protein synthesis should terminate. In DNA sequences, there are three primary stop codons: "TAA", "TAG", and "TGA". These codons do not code for any amino acids. Instead, they signal the ribosome that the end of the protein-coding region has been reached. Once a ribosome encounters a stop codon, it releases the newly synthesized protein chain. Recognizing these regions is crucial in DNA sequence analysis, as a correctly identified stop codon ensures that the entire protein is translated accurately. In the provided sequence, "TAG" and "TAA" are present and play crucial roles in identifying the ends of potential coding regions, even if no start codon was observed.
DNA Sequence Analysis
DNA sequence analysis involves examining the nucleotide arrangement in DNA to deduce information like gene, protein, and trait organization. This process allows scientists to identify important features such as genes, promoters, regulatory regions, and possible open-reading frames (ORFs). Key steps in this analysis include:
  • Searching for start and stop codons.
  • Determining the correct reading frame.
  • Identifying potential ORFs.
  • Comparing sequences against known databases.
This detailed examination helps predict protein coding regions and provides insight into genetic functions. It’s the backbone of genetic research and essential for bioinformatics applications.
Protein Coding
Protein coding refers to the segment of DNA that contains the information necessary to build a protein. This information is encoded in a series of nucleotide triplets called codons. Each codon corresponds to a specific amino acid or a stop signal during protein synthesis. To code for a protein, a sequence must start with an ATG start codon, followed by consecutive codons that dictate the amino acid order, and finally a stop codon to flag the process's end. Understanding protein coding regions is crucial for deciphering gene function and for engineering synthetic genes. The absence or mutation of these critical areas could result in dysfunctional proteins, impacting organismal development or health.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.