/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for The Cell: A Molecular Approach Chapter 5 - (Page 1) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 2

Find an open-reading frame in the following sequence. ACTTAGCCCCGTAAGCTCGATT

Problem 2

Many of the genes required for cell viability are common to all organisms. Can you give three examples of genes required for the viability of both human cells and bacteria? What are some genes that would be required for viability of bacteria but not human cells?

Problem 2

How could you compare the protein composition of mitochondria from cancer cells and normal cells?

Problem 3

Why is it more difficult to identify regulatory sequences than proteincoding sequences?

Problem 3

You are interested in a protein called Mox, which is found in the nucleus of cancer cells but the cytoplasm of normal cells by immunofluorescence. Mass spectrometry indicates that one peptide of Mox differs by a molecular mass of 78 in cancer versus normal cells, with the highermass peptide found in the nucleus. How do you interpret these results?

Problem 4

You are studying a protein called Nef, which is phosphorylated in nerve cells but not in other cell types. You hypothesize that phosphorylation affects the participation of Nef in protein-protein interactions. How can you compare the proteins that interact with phosphorylated versus nonphosphorylated Nef? Would the yeast two-hybrid system be useful in this analysis?

Problem 5

You are using RNA-seq to analyze gene expression in breast cancers compared to normal breast cells. One gene of potential interest yields about five times the frequency of reads in normal cells. What does this say about the gene's level of expression in the two cell types? Do you think this gene could have a role in cancer?

Problem 5

You observe stimulatory crosstalk between two parallel signaling pathways. What biological significance might this have?

Problem 6

How can synthetic biology contribute to understanding natural biological systems?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks