/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 30 The \(5^{\prime}\) terminus of a... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The \(5^{\prime}\) terminus of a human mRNA has the following sequence: \(5^{\prime} \operatorname{cap}-\operatorname{GAAGAGACAAGGTCAUGGCCAU}\) AUGCUUGUUCCAAUCGUUAGCUGCGCAGGAUCGCCCUGGG......3' When this mRNA is translated, what amino acid sequence will be specified by this portion of the mRNA?

Short Answer

Expert verified
The amino acid sequence is Met-Leu-Val-Pro-Ile-Val-Ser-Cys-Ala-Gly-Ser-Pro.

Step by step solution

01

Identify the Start Codon

In most eukaryotic mRNA sequences, the start codon is AUG, which signals the beginning of translation. Scan the sequence provided for this start codon. Given Sequence: AUGCUUGUUCCAAUCGUUAGCUGCGCAGGAUCGCCCUGGG Here, the start codon AUG is present at the beginning of the sequence.
02

Break Sequence into Codons

The mRNA sequence is read in sets of three nucleotides, known as codons. Starting from AUG, break down the sequence into codons. Sequence: AUG-CUU-GUU-CCA-AUC-GUU-AGC-UGC-GCA-GGA-UCG-CCC-UGG-G... Note that UGG is incomplete and can't form a codon here.
03

Translate Codons into Amino Acids

Using a codon chart, translate each three-nucleotide codon into its corresponding amino acid. - AUG: Methionine (Met) - CUU: Leucine (Leu) - GUU: Valine (Val) - CCA: Proline (Pro) - AUC: Isoleucine (Ile) - GUU: Valine (Val) - AGC: Serine (Ser) - UGC: Cysteine (Cys) - GCA: Alanine (Ala) - GGA: Glycine (Gly) - UCG: Serine (Ser) - CCC: Proline (Pro)
04

Compile the Amino Acid Sequence

Combine the amino acids identified in Step 3 to form the complete sequence, excluding the incomplete codon at the end. Amino Acid Sequence: Met-Leu-Val-Pro-Ile-Val-Ser-Cys-Ala-Gly-Ser-Pro

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Start Codon
In the process of mRNA translation, the start codon plays a pivotal role. It is the signal for the ribosome to begin synthesizing proteins. The most common start codon in eukaryotic mRNA is AUG, which matches with the amino acid methionine.
This is not coincidental, as methionine has special significance in protein synthesis. In all eukaryotic cells, methionine serves as the initiator amino acid and is the first to be added to all new protein chains.
While AUG is universal as a start codon, it is important to note that not every AUG in an mRNA sequence will necessarily start translation. The position and context within the strand are crucial. Scanning the mRNA for the correct AUG codon facilitates accurate translation and proper protein formation.
Codon Chart
A codon chart is a vital tool used to translate mRNA into the sequence of amino acids. This chart allows you to comprehend which three-nucleotide mRNA codon corresponds to which amino acid. Each three-letter codon is specific to one of the 20 different amino acids.
The codon chart serves as a map for genetic information, ensuring that the correct protein is assembled during translation. Using the chart, you can identify any given codon's matching amino acid quickly and efficiently.
It's important to recognize that the codon chart also highlights the degeneracy of the genetic code. For instance, several different codons can code for the same amino acid, providing a level of redundancy that can safeguard against some mutations.
Amino Acid Sequence
Creating an amino acid sequence is the ultimate goal of translating mRNA. This process involves decoding the mRNA sequence into a chain of amino acids, ultimately forming a functioning protein.
The linear amino acid sequence is determined by the specific order of codons read from the mRNA. Each set of three nucleotides directs the addition of a specific amino acid to the growing polypeptide chain.
In the given exercise, this sequence starts with methionine and continues with leucine, valine, proline, and more, creating a protein's backbone that folds into its unique structure. This sequence is essential in defining the protein's specific role and activity in the cell.
Eukaryotic mRNA
Eukaryotic mRNA, like the one shown in the exercise, is distinct in its complexity and processing. It is synthesized in the nucleus and carries genetic information from DNA to the ribosome, where it guides protein synthesis.
Eukaryotic mRNA is characterized by several structural features, such as the 5' cap and the poly-A tail. These modifications protect the mRNA from degradation and aid in its export from the nucleus.
Furthermore, eukaryotic mRNAs undergo splicing, where non-coding regions (introns) are removed. Only the coding regions (exons) are left to be translated. This processing allows for a diverse range of proteins to be encoded by a single gene through alternative splicing.
Genetic Code
The genetic code is the language by which the nucleotide sequence of mRNA is translated into the amino acid sequence of proteins. This code consists of 64 codons, each representing either an amino acid or a stop signal.
The genetic code is universal, meaning it is used by nearly all organisms, from bacteria to humans, to encode the proteins necessary for life.
It is also unambiguous. Each codon specifies only one amino acid, which ensures fidelity during protein synthesis.
The genetic code's non-overlapping nature requires that each codon be read sequentially, without skipping bases. Understanding this code is crucial for genetic engineering and biotechnology, as it enables scientists to predict and modify protein expression.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.