/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 6 List three ways in which the mRN... [FREE SOLUTION] | 91影视

91影视

List three ways in which the mRNAs of eukaryotes differ from the mRNAs of prokaryotes.

Short Answer

Expert verified
Eukaryotic mRNAs are capped, have a poly-A tail, and are usually monocistronic; prokaryotic mRNAs are not.

Step by step solution

01

Eukaryotic mRNA Processing Features

In eukaryotes, mRNA undergoes extensive processing before it becomes mature mRNA. The primary transcript (pre-mRNA) in eukaryotes undergoes capping, polyadenylation, and splicing. In contrast, prokaryotic mRNA does not undergo similar processing to such an extent.
02

Structural Difference in mRNA

Eukaryotic mRNAs typically have a 5' cap structure, which is a modified guanine nucleotide added to the 5' end of the mRNA. This cap is not present in prokaryotic mRNAs. Additionally, eukaryotic mRNAs generally contain a poly-A tail at the 3' end, which is a series of adenine nucleotides added after transcription. Prokaryotic mRNAs typically lack these modifications.
03

Complexity and Longevity

Eukaryotic mRNAs are usually monocistronic, meaning they contain the genetic information to translate into a single protein. In contrast, prokaryotic mRNAs are often polycistronic and can encode multiple proteins in a single mRNA molecule. Eukaryotic mRNAs also tend to have a longer half-life compared to prokaryotic mRNAs.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

eukaryotic mRNA processing
In eukaryotic cells, mRNA goes through a series of modifications before it is ready to be translated into proteins. This process, known as "mRNA processing," includes several essential steps: capping, splicing, and polyadenylation. The initial mRNA transcript, also known as pre-mRNA, is created from DNA in the nucleus. Before it becomes mature mRNA and leaves the nucleus, it needs to be processed.
  • Capping: This involves the addition of a special nucleotide to the 5' end of the mRNA, which is crucial for stability and protection.
  • Splicing: This process removes non-coding regions, called introns, from the pre-mRNA, leaving only the coding sequences, known as exons, to produce a continuous coding sequence.
  • Polyadenylation: Adding a poly-A tail to the 3' end of the mRNA which aids in stability and transport out of the nucleus.
These processes ensure that the mRNA is adequately prepared for protein synthesis, enabling the cell to use its genetic information efficiently.
5' cap
The "5' cap" is a unique feature of eukaryotic mRNA which significantly distinguishes it from prokaryotic mRNA. It involves the addition of a modified guanine nucleotide to the 5' end of the mRNA transcript soon after transcription begins. This capping is essential because:
  • Protection from Degradation: The cap protects the mRNA from enzymatic degradation, allowing it to have a longer lifespan within the cell.
  • Initiation of Translation: The cap structure is recognized by the ribosome, which is essential for the initiation of protein synthesis.
  • Export from the Nucleus: The presence of the 5' cap is involved in exporting the mature mRNA from the nucleus to the cytoplasm.
Without the 5' cap, mRNA would degrade rapidly, and protein synthesis would be less efficient, impacting cell function and viability.
poly-A tail
The "poly-A tail" is another important modi铿乧ation of eukaryotic mRNA, added to the 3' end of the transcript through a process called polyadenylation. This tail consists entirely of adenine nucleotides and is pivotal for several reasons:
  • Stability: The poly-A tail increases the stability of the mRNA molecule, preventing it from degrading too quickly.
  • Transport: It assists in the export of the mRNA from the nucleus to the cytoplasm where translation occurs.
  • Translation Efficiency: A longer poly-A tail can enhance the efficiency of translation, ensuring more protein is synthesized from each mRNA molecule.
Through these roles, the poly-A tail is vital for ensuring that the mRNA remains intact for sufficient time to be translated into a protein effectively.
monocistronic vs polycistronic mRNA
Eukaryotic and prokaryotic mRNAs can also differ in how they encode proteins. Eukaryotic mRNA is usually "monocistronic," meaning it carries the genetic information for the translation of one protein. This single-gene encoding is typical of the more complex eukaryotic organisms, ensuring precise regulation and expression of each protein.
In contrast, prokaryotic mRNA can be "polycistronic," encoding multiple proteins within a single mRNA molecule. This means the prokaryotic mRNA can have multiple start and stop codons, each related to different genes. This polycistronic nature allows prokaryotes to express several proteins from one transcript, which is efficient for bacterial cells that need to quickly adapt to changes in their environment.
This distinction impacts the regulation of gene expression and protein synthesis, with eukaryotes typically having more controlled and varied expression levels due to their monocistronic mRNA.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Distinguish between DNA and RNA (a) chemically, (b) functionally, and (c) by location in the cell.

What role(s) do spliceosomes play in pathways of gene expression? What is their macromolecular structure?

Two eukaryotic genes encode two different polypeptides, each of which is 335 amino acids long. One gene contains a single exon; the other gene contains an intron 41,324 nucleotide pairs long. Which gene would you expect to be transcribed in the least amount of time? Why? When the mRNAs specified by these genes are translated, which mRNA would you expect to be translated in the least time? Why?

The biosynthesis of metabolite \(X\) occurs via six steps catalyzed by six different enzymes. What is the minimal number of genes required for the genetic control of this metabolic pathway? Might more genes be involved? Why?

(a) Which of the following nuclear pre-mRNA nucleotide sequences potentially contains an intron? 1) \(5^{\prime}-\) UGACCAUGGCGCUAACACUGCCAAUUGGCAAUACUGACCUGAUAGCAUCAGCCAA-3' 2) \(5^{\prime}-\) UAG UC UCAUC UGUCCAU UGACU UC GAAACUGAAUCGUAACUCCUACGUCUAUGGA-3' 3) \(5^{\prime}\) -UAGCUGUUUGUCAUGACUGACUGGUCACUAUCGUACUAACCUGUCAUGCAAUGUC-3' 4) \(5^{\prime}\) -UAGCAGUUCUGUCGCCUCGUGGUGCUGCUGGCCCUUCGUCGCUCGGGCUUAGCUA-3' 5) \(5^{\prime}\) -UAGGUUCGCAUUGACGUACUUCUGAAACUACUAACUACUAACGCAUCGAGUCUCAA-3' (b) One of the five pre-mRNAs shown in (a) may undergo RNA splicing to excise an intron sequence. What mRNA nucleotide sequence would be expected to result from this splicing event?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.