/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 9 Eukaryotes have repair systems t... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Eukaryotes have repair systems that prevent mutations due to copying errors and exposure to mutagens. What are the three excision-repair systems found in eukaryotes, and which one is responsible for correcting thymine-thymine dimers that form as a result of UV light damage to DNA?

Short Answer

Expert verified
The three systems are BER, NER, and MMR. NER corrects thymine dimers.

Step by step solution

01

Understanding the Exercise

We need to identify the three excision-repair systems found in eukaryotic cells and determine which specifically repairs thymine-thymine dimers, which are caused by UV light.
02

Identify Excision-Repair Systems in Eukaryotes

The three excision-repair systems in eukaryotes are Base Excision Repair (BER), Nucleotide Excision Repair (NER), and Mismatch Repair (MMR). Each of these systems plays a role in detecting and correcting different types of DNA damage.
03

Determine Which System Corrects Thymine-Thymine Dimers

Thymine-thymine dimers are particular forms of DNA damage caused by UV light. The repair system responsible for correcting this damage is Nucleotide Excision Repair (NER). NER identifies and removes bulky lesions such as thymine dimers and replaces them with the correct nucleotides.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Excision-Repair Systems
When it comes to keeping DNA functioning correctly, eukaryotic cells employ three key excision-repair systems. These systems are Base Excision Repair (BER), Nucleotide Excision Repair (NER), and Mismatch Repair (MMR). Each of these serves a unique purpose in fixing various kinds of DNA damage. For instance, BER typically handles small, non-helix-distorting base lesions, focusing on single base repairs. In contrast, MMR is responsible for fixing errors that slip through during DNA replication, such as mispaired nucleotides. This systematic approach allows cells to maintain genetic integrity by quickly identifying and correcting mistakes.
By employing these diverse repair mechanisms, cells can prevent mutations that might otherwise lead to various genetic disorders or even cancer.
Thymine-Thymine Dimers
One particularly troublesome form of DNA damage caused by ultraviolet (UV) light is the formation of thymine-thymine dimers. These occur when UV light induces chemical bonding between two adjacent thymine residues in a DNA strand. Such bonding distorts the DNA helix, making it difficult for cellular machinery to read and replicate the DNA accurately.
Thymine-thymine dimers, if left unrepaired, can lead to mutations, as they block normal cellular processes. Cells must address these blockages swiftly to prevent the errors from becoming permanent. Understanding how these dimers form and their impact on the DNA helix helps underscore the importance of efficient repair systems like Nucleotide Excision Repair.
Nucleotide Excision Repair
The hero of the story when it comes to fixing thymine-thymine dimers is Nucleotide Excision Repair (NER). NER is specifically designed to recognize bulky, helix-distorting lesions in the DNA, such as those caused by UV light. Here's a simplified breakdown of how NER works:
  • First, it identifies the damaged section of DNA by sensing distortions in the DNA helix.
  • Once identified, a complex of proteins unwinds the DNA around the site of damage.
  • Enzymes then excise the damaged nucleotides, removing a section of the DNA strand.
  • The gap is filled with new, correct nucleotides using the undamaged strand as a template.
  • Finally, the DNA backbone is sealed to complete the repair process.
By understanding and recognizing the efficient process of NER, we can appreciate how cells combat potential DNA damage and prevent mutations. This system, crucial for maintaining genetic stability, is a shining example of cellular defense against environmental threats like UV radiation.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

DNA repair systems are responsible for maintaining genomic fidelity in normal cells despite the high frequency with which mutational events occur. What type of DNA mutation is generated by (a) UV radiation and (b) ionizing radiation? Describe the system responsible for repairing cach of these types of mutations in mammalian cells. Postulate why a loss of function in one or more DNA repair systems typifies many cancers.

While investigating the function of a specific growth factor receptor gene from humans, researchers found that two types of proteins are synthesized from this gene. A larger protein containing a membranc-spanning domain recognizes growth factors at the cell surface, stimulating a spccific downstream signaling pathway. In contrast, a rclated, smaller protein is secreted from the cell and binds available growth factor circulating in the blood, thus inhibiting the downstream signaling pathway. Speculate on how the cell synthesizes these disparate proteins.

Use the key provided below to determine the amino acid sequence of the polypeptide produced from the following DNA sequence. Intron sequences are highlighted. Note: Not all amino acids in the key will be used. \(5^{\prime}\) TTCTAAACGCATGAAGCACCGICTCAGAGCCAGIGA \(3^{\prime}\) \(3^{\prime}\) AAGATTTGCGTACTTCGTGGCAGAGTCTCGGTCACT \(5^{\prime}\) \(\rightarrow\) Direction of DNA unwinding \\[\begin{array}{l}\text { Asn }=\mathrm{AAU} \mathrm{Cys}=\mathrm{TCG} \mathrm{Gly}=\mathrm{CAG} \text { I lis }=\mathrm{CAU} \mathrm{L} y \mathrm{s}=\mathrm{AAG} \\ \mathrm{Met}=\mathrm{AUG} \mathrm{Phe}=\mathrm{UUC} \mathrm{Ser}=\mathrm{AGC} \mathrm{Tyr}=\mathrm{UAC} \mathrm{Val}=\mathrm{GUC} ; \mathrm{GUA}\end{array}\\]

The DNA repair systems preferentially target the newly synthesized strand. Why is this important?

What difference between RNA and DNA helps to explain the greater stability of DNA? What implications does this have for the function of DNA?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.