/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 16 If tRNA is the adaptor for trans... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

If tRNA is the adaptor for translation, what is the ribosome?

Short Answer

Expert verified
Ribosomes are the molecular machines where translation occurs.

Step by step solution

01

Identify the Role of Ribosomes in Translation

Ribosomes are molecular machines in the cell that facilitate the process of translation, where messenger RNA (mRNA) is decoded to produce a specific protein. They are composed of ribosomal RNA (rRNA) and proteins.
02

Understand the Function of a Molecular Machine

Ribosomes read the sequence of codons in the mRNA strand and help to assemble the corresponding sequence of amino acids to form a protein. They provide a platform or scaffold where this assembly process can occur.
03

Comparison to tRNA

While tRNA acts as an adaptor to match amino acids with the corresponding mRNA codons, the ribosome serves as the site or machinery where the translation process takes place, efficiently linking tRNA and mRNA together to synthesize proteins.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Translation
Translation is a fundamental biological process in which ribosomes synthesize proteins by decoding messenger RNA (mRNA). Proteins, made up of long chains of amino acids, are crucial for nearly all cellular functions.
During translation, the ribosome moves along the mRNA strand, reading its sequence in groups of three nucleotides, called codons. Each codon specifies a particular amino acid, guiding the ribosome on which building block to add next in the growing protein chain.
  • This process is vital because it ensures that the genetic information in DNA is expressed in the form of functional proteins.
  • Translation occurs in the cytoplasm of the cell, where ribosomes are readily available to interact with mRNA and other components needed for protein synthesis.
tRNA
Transfer RNA, or tRNA, is often known as the adaptor molecule. Its main function is to bring the correct amino acids to the ribosome during the process of translation. Each tRNA molecule carries a specific amino acid and features a unique region known as the anticodon.
h4. How tRNA Works:
The anticodon of a tRNA molecule is a set of three nucleotides that pairs with the complementary codon on the mRNA strand. This pairing ensures that the right amino acid is added to the growing polypeptide chain, based on the sequence encoded by the mRNA.
  • tRNA is essential in translating the genetic code into proteins, thus playing a crucial role in cellular functions.
  • There are different types of tRNA, each responsible for transferring a specific amino acid.
tRNA's embodiment as a well-suited adaptor allows it to serve as a bridge, connecting the genetic code from mRNA to the amino acid sequence of proteins.
mRNA
Messenger RNA, abbreviated as mRNA, is a type of RNA that serves as a transcript of the genetic information in DNA. This information guides the synthesis of proteins during translation.
In eukaryotic cells, the process starts with the transcription of DNA to form a pre-mRNA in the nucleus. This pre-mRNA is then processed to become mature mRNA, which exits the nucleus and enters the cytoplasm, where it’s ready to be translated by ribosomes.
  • mRNA carries the instructions in the form of a sequence of codons, each representing a specific amino acid.
  • The "m" in mRNA stands for messenger, highlighting its role in conveying genetic messages from the DNA to the ribosome.
Without mRNA, cells could not build proteins according to the genetic blueprint, emphasizing its critical function in biology.
Amino Acids
Amino acids are the building blocks of proteins, the complex molecules crucial for life’s processes. Each protein consists of one or more chains of amino acids arranged in a specific order, as directed by mRNA during protein synthesis.
There are 20 standard amino acids that can combine in various sequences to form a vast array of proteins. This diversity allows proteins to perform countless functions, such as catalyzing biochemical reactions, providing structural support, and regulating cell processes.
  • Amino acids are linked together by peptide bonds during the process of translation, forming polypeptide chains that fold into functional proteins.
  • The sequence and number of amino acids define a protein's unique properties and functions.
In summary, amino acids are indispensable in forming proteins vital for life, driven by the genetic instructions encoded in mRNA.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Our immune system makes many different proteins that protectusfrom viral and bacterial infection. Biotechnology companies must produce large quantities of these immune proteins for human testing and eventual sale to the public. To this end, their scientists engineer bacterial or human cell cultures to express these immune proteins. Explain why proteins isolated from bacterial cultures are often inactive, whereas the same proteins isolated from human cell cultures are active (functional)

If life were found on another planet, do you think that it would have the same genetic code? Justify your answer.

Consider the genes that specify the structure of hemoglobin. Arrange the following events in the most likely sequence in which they would take place. a. Anemia is observed. b. The shape of the oxygen-binding site is altered. c. An incorrect codon is transcribed into hemoglobin mRNA. d. The ovum (female gamete) receives a high radiation dose. e. An incorrect codon is generated in the DNA of a hemoglobin gene. f. \(A\) mother \((\text { an } X \text { -ray technician })\) accidentally steps in front of an operating X-ray generator. g. A child dies. H. the oxygen-transport capacity of the body is severely impaired. i. The tRNA anticodon that lines up is one of a type that brings an unsuitable amino acid. j. Nucleotide-pair substitution occurs in the DNA of a gene for hemoglobin.

A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the \(5^{\prime}\) and the \(3^{\prime}\) ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right ends, respectively, and the same strand of DNA is transcribed, how long will the resultant polypeptide be? d. Assume that the original molecule is intact and that the bottom strand is transcribed from left to right. Give the RNA base sequence, and label the \(5^{\prime}\) and \(3^{\prime}\) ends of the anticodon that inserts the fourth amino acid into the nascent polypeptide. What is this amino acid?

Explain why antibiotics, such as erythromycin and Zithromax, that bind the large ribosomal subunit do not harm us.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.