/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 28 The DNA polymerases are position... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that an Okazaki fragment is made from this segment, what will be the fragment's sequence? Label its \(5^{\prime}\) and \(3^{\prime}\) ends. \(5^{\prime} \ldots.\) CCTTAAGACTAACTACTTACTGGGATC....3' \(3^{\prime} \ldots .\) GGAATTCTGATTGATGAATGACCCTAG....5'

Short Answer

Expert verified
The Okazaki fragment is 5' CCTTAAGACTAACTACTTACTGGGATC 3'.

Step by step solution

01

Understanding DNA Strands

The DNA segment provided has two strands: a leading and a lagging strand. The upper strand goes from the 5' to the 3' direction, indicating it is the template for the lagging strand synthesis which proceeds in a 3' to 5' direction.
02

Identifying the Template Strand

Since DNA polymerases are moving from right to left, the lower strand (3' to 5' direction) is used as the template for the Okazaki fragment. This is because Okazaki fragments are synthesized on the lagging strand.
03

Synthesizing the Okazaki Fragment

The synthesis proceeds in short segments on the template strand. The template strand sequence for the Okazaki fragment begins from the rightmost side, proceeding leftwards: GGAATTCTGATTGATGAATGACCCTAG.
04

Forming the Okazaki Fragment Sequence

Using base-pair complementarity (A-T and G-C pairing), write the complementary bases to the sequence determined in Step 3. The Okazaki fragment sequence will be from 5' to 3' opposite of the template: CCTTAAGACTAACTACTTACTGGGATC.
05

Labeling 5' and 3' Ends

The newly synthesized Okazaki fragment extends from the 5' to the 3' end so the labeled Okazaki fragment sequence is: 5' CCTTAAGACTAACTACTTACTGGGATC 3'.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA Polymerase
DNA polymerases are essential enzymes in the process of DNA replication. They are responsible for synthesizing new DNA strands by adding nucleotides, which are the building blocks of DNA. DNA polymerase works by attaching to the DNA template strand and matching it with complementary nucleotides, effectively constructing a new, complementary strand.

One interesting feature of DNA polymerases is their directionality. These enzymes can only add nucleotides to the 3' end of a new DNA strand, meaning they synthesize in a 5' to 3' direction. This is crucial for DNA replication and has specific implications for how DNA replication proceeds on different strands of the DNA double helix.

  • DNA polymerases synthesize DNA in a 5' to 3' direction.
  • They utilize nucleotides to form a complementary DNA strand based on the template strand.
  • The activity of DNA polymerase is foundational for the accurate duplication of genetic information during cell division.
Lagging Strand Synthesis
The process of lagging strand synthesis occurs during DNA replication when DNA polymerase synthesizes DNA in short, discrete segments known as Okazaki fragments. This is necessary due to the directional activity of DNA polymerase, which can only add nucleotides in the 5' to 3' direction.

The DNA double helix is anti-parallel, meaning the two strands run in opposite directions. As a result, the lagging strand must be synthesized in short segments moving away from the replication fork and then joined together to form a continuous strand.

Here's how it works:
  • DNA polymerase synthesizes short segments, known as Okazaki fragments, in the 5' to 3' direction.
  • These fragments are then bonded together by the enzyme DNA ligase to form a continuous strand.
  • This process ensures both strands of the DNA double helix are accurately replicated.
In summary, lagging strand synthesis ensures that even with the directionality restriction of DNA polymerase, the entire DNA molecule is accurately and completely replicated.
DNA Replication Steps
The process of DNA replication is a complex and highly orchestrated event involving several steps and key proteins. It ensures that each cell has an identical set of DNA after cell division. Here's a simplified overview of the key steps of DNA replication:

  • Initiation: The process starts at specific locations in the DNA known as origins of replication. Helicase, an enzyme, unwinds and separates the two strands of the DNA double helix, creating a replication fork.
  • Elongation: DNA polymerase begins adding nucleotides to the exposed DNA templates. On the leading strand, this process is straightforward, as DNA polymerase works continuously in a 5' to 3' direction. On the lagging strand, however, DNA polymerase synthesizes Okazaki fragments, which are later joined by DNA ligase.
  • Termination: Once the entire DNA molecule has been replicated, the replication machinery disassembles. The result is two identical DNA molecules, each containing one original and one newly synthesized strand.


This meticulous process ensures the accurate duplication of genetic material, allowing for the proper functioning and reproduction of cells.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

What is meant by a primer, and why are primers necessary for DNA replication?

If thymine makes up 15 percent of the bases in a specific DNA molecule, what percentage of the bases is cytosine?

E. coli chromosomes in which every nitrogen atom is labeled (that is, every nitrogen atom is the heavy isotope \(^{15} \mathrm{N}\) instead of the normal isotope \(^{14} \mathrm{N}\) ) are allowed to replicate in an environment in which all the nitrogen is \(^{14} \mathrm{N}\). Using a solid line to represent a heavy polynucleotide chain and a dashed line for a light chain, sketch each of the following descriptions: a. The heavy parental chromosome and the products of the first replication after transfer to a \(^{14} \mathrm{N}\) medium, assuming that the chromosome is one DNA double helix and that replication is semiconservative. b. Repeat part \(a\), but now assume that replication is conservative. c. Repeat part \(a,\) but assume that the chromosome is in fact two side-by-side double helices, each of which replicates semiconservatively. d. Repeat part \(c,\) but assume that each side-by-side double helix replicates conservatively and that the overall chromosome replication is semiconservative. e. If the daughter chromosomes from the first division in \(^{14} \mathrm{N}\) are spun in a cesium chloride density gradient and a single band is obtained, which of the possibilities in parts \(a\) through \(d\) can be ruled out? Reconsider the Meselson and Stahl experiment: What does it prove?

Both strands of a DNA molecule are replicated simultaneously in a continuous fashion on one strand and a discontinuous one on the other. Why can't one strand be replicated in its entirety (from end to end) before replication of the other is initiated?

What would happen if, in the course of replication, the topoisomerases were unable to reattach the DNA fragments of each strand after unwinding (relaxing) the DNA molecule?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.