/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 19 Compare and contrast the neutral... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 29: Problem 19

Compare and contrast the neutral theory of evolution and the Darwinian (i.e., selectionist) theory of evolution. Explain why the neutral theory of evolution is sometimes called non-Darwinian evolution.

Short Answer

Expert verified
Darwinian evolution focuses on natural selection, with advantageous traits being passed down generations for better survival. In contrast, the neutral theory of evolution emphasizes on genetic drift and states that most evolutionary changes are neutral, affecting neither survival nor reproduction. It's termed 'non-Darwinian' as it does not consider natural selection as a primary evolutionary driving force.

Step by step solution

01

Define Darwinian Evolutionary Theory

Darwinian evolution, also known as the selectionist theory of evolution, propounds that natural selection is the main driving force behind evolution. It states that organisms possessing advantageous traits that enhance survival or reproduction rates are likely to pass these beneficial traits to their offspring. Therefore, over generations, beneficial traits become widespread within a population.
02

Define Neutral Theory of Evolution

On the other hand, the neutral theory of evolution argues that the majority of evolutionary changes occur due to genetic drift rather than natural selection. It posits that most genetic variations are neutral and do not affect the organism's ability to survive or reproduce. Thus, changes in gene frequency within a population are largely due to random genetic drift.
03

Compare and Contrast

Darwinian and neutral theory of evolution are fundamentally different. Darwinian evolution emphasizes the role of natural selection that promotes fit and adapted species over time, whereas the neutral theory highlights the role of random genetic drift and argues that a large proportion of evolutionary changes are neutral. Both theories provide mechanisms to explain the biodiversity of life on Earth but from differing perspectives.
04

Explain 'Non-Darwinian' Term

The term non-Darwinian is linked to the neutral theory of evolution because it downplays the role of natural selection, a core element of Darwinian evolution. It focuses on random changes and genetic drift, which are based on chance and not on the 'survival of the fittest' principle central to Darwinian evolution.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGIATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.

Would each of the following examples of reproductive isolation be considered a prezygotic or postzygotic mechanism? A. Horses and donkeys can interbreed to produce mules, but the mules are infertile. B. Three species of the orchid genus Dendrobium produce flowers 8 days, 9 days, and 11 days after a rainstorm. The flowers remain open for 1 day. C. Two species of fish release sperm and eggs into seawater at the same time, but the sperm of one species do not fertilize the eggs of the other species. D. Two tree frogs, Hyla chrysoscelis (diploid) and Hyla versicolor (tetraploid), can produce viable offspring, but the offspring are sterile.

What is meant by the term reproductive isolation? Give several examples.

Discuss whether the phenomenon of reproductive isolation applies to bacteria, which reproduce asexually. How would a geneticist divide bacteria into separate species?

What is a species? What types of observations do researchers analyze when trying to identify species?
See all solutions

Recommended explanations on Biology Textbooks

Plant Biology

Read Explanation

Biological Organisms

Read Explanation

Cells

Read Explanation

Communicable Diseases

Read Explanation

Chemistry of Life

Read Explanation

Biology Experiments

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.