Chapter 13: Problem 1
An mRNA has the following sequence: 5'-GGCGAUGGGCAAUAAACCGGGCCAGUAAGC-3' Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA.
Short Answer
Expert verified
The start codon is 'AUG'. The corresponding amino acid sequence is Methionine (M) - Glycine (G) - Asparagine (N) - Lysine (K) - Proline (P) - Glycine (G) - Glutamine (Q)
Step by step solution
01
Identification of the Start Codon
Search the mRNA sequence to find the start codon. The start codon is AUG. In this case, the mRNA sequence: 'GGCGAUGGGCAAUAAACCGGGCCAGUAAGC' has a start codon at the positions 5-7.
02
Splitting the Sequence into Codons
Split the sequence into codons, groups of three nucleotides, starting from the start codon. The codons will be: AUG-GGC-AAU-AAA-CCG-GGC-CAG-UAA-GC.
03
Translation of Codons to Amino Acids Using the Genetic Code
Translate each codon into its corresponding amino acid, using a table that represents the genetic code. The translation would be: Met (M) - Gly (G) - Asn (N) - Lys(K) - Pro (P) - Gly (G) - Gln (Q)
04
Identify the Stop Codon
The reading of codons should continue until reaching a stop codon. In this case, the stop codon is 'UAA', so the sequence stops there.
05
Final Amino Acid Sequence
Write out the final sequence of amino acids. Therefore the final amino acid sequence is: M-G-N-K-P-G-Q
Unlock Step-by-Step Solutions & Ace Your Exams!
-
Full Textbook Solutions
Get detailed explanations and key concepts
-
Unlimited Al creation
Al flashcards, explanations, exams and more...
-
Ads-free access
To over 500 millions flashcards
-
Money-back guarantee
We refund you if you fail your exam.
Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
mRNA translation
mRNA translation is a vital biological process where the genetic information encoded in mRNA (messenger RNA) is decoded to produce a specific protein. This process occurs in the cytoplasm of the cell. During translation, ribosomes read the mRNA sequence, which is composed of nucleotide bases grouped into sets of three called codons. Each codon specifies a particular amino acid. The translation process begins at the start codon and continues until a stop codon is encountered, at which point the polypeptide chain is released from the ribosome, resulting in a functional protein.
genetic code
The genetic code is the set of rules used by cells to translate the mRNA sequence into an amino acid sequence in proteins. It is universal and applies to nearly all organisms. The genetic code consists of 64 codons, with each codon signaling for a specific amino acid or a stop signal for translation. For example:
- AUG codes for methionine (Met), which also serves as the start codon.
- UAA, UAG, and UGA are stop codons, signaling the end of the translation process.
amino acid sequence
An amino acid sequence is the order in which amino acids are arranged in a polypeptide chain. This sequence is determined during the translation process by the order of codons in the mRNA sequence. Each amino acid in the sequence is added one after another as dictated by the mRNA code. This sequence of amino acids ultimately determines the structure and function of the protein being synthesized.
In the provided example, the mRNA sequence was translated into the amino acid sequence: Met (M) - Gly (G) - Asn (N) - Lys (K) - Pro (P) - Gly (G) - Gln (Q), showing how specific codons direct the assembly of the protein.
In the provided example, the mRNA sequence was translated into the amino acid sequence: Met (M) - Gly (G) - Asn (N) - Lys (K) - Pro (P) - Gly (G) - Gln (Q), showing how specific codons direct the assembly of the protein.
start codon
The start codon is an essential part of the mRNA translation process because it signifies where the translation of the mRNA into protein begins. In almost all organisms, the start codon is AUG, which translates into the amino acid methionine. During translation, when the ribosome identifies the AUG start codon in an mRNA sequence, it begins assembling the amino acid chain from that point forward. In the exercise example, the start codon is found at position 5-7 in the mRNA sequence, marking the beginning of the translation process and the addition of methionine to the amino acid sequence.
stop codon
A stop codon plays a critical role in signaling the end of the protein synthesis process during mRNA translation. There are three stop codons: UAA, UAG, and UGA. When a ribosome encounters a stop codon, the translation process is terminated, and the newly formed polypeptide chain is released. This is a crucial step as it indicates the completion of the protein and prevents the addition of unnecessary amino acids.
In the given exercise, the stop codon "UAA" is found, and it halts translation, finalizing the amino acid sequence. Recognizing stop codons ensures proteins are synthesized correctly and efficiently.
In the given exercise, the stop codon "UAA" is found, and it halts translation, finalizing the amino acid sequence. Recognizing stop codons ensures proteins are synthesized correctly and efficiently.