/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 31 Suppose that the string of A nuc... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Suppose that the string of A nucleotides following the inverted repeat in a rho-independent terminator was deleted but theinverted repeat was left intact. How would this deletion affect termination? What would happen when RNA polymerase reached this region?

Short Answer

Expert verified
Deletion of the poly-U tract prevents proper termination, causing RNA polymerase to continue transcription.

Step by step solution

01

Understanding the Role of Inverted Repeats

In a rho-independent terminator, inverted repeats form a stable stem-loop structure (hairpin) in the RNA transcript. This hairpin structure is crucial for terminating transcription because it causes the RNA polymerase to pause.
02

Role of the Poly-U Tract

Following the inverted repeat, there is usually a series of adenines (A) on the DNA template, which results in a string of uracils (U) in the RNA. This U-rich region forms weak bonds with the DNA, facilitating the dissociation of the RNA transcript from the DNA, thus terminating transcription.
03

Impact of Deleting the Poly-U Region

If the string of A nucleotides following the inverted repeat is deleted, the poly-U tail is missing. This tail is necessary because the weak bonds allow easy separation of the RNA from the DNA, aiding in the termination process. Without it, the hairpin alone may not be sufficient to terminate transcription.
04

What Happens Without the Poly-U Tract

Without the poly-U sequence, the RNA polymerase is less likely to dissociate from the DNA template after the hairpin is formed. Instead of terminating, the RNA polymerase might continue transcribing downstream, leading to extended and possibly non-functional RNA transcripts.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Inverted Repeat
Inverted repeats are sequences of nucleotides that are identical but oriented in opposite directions on the DNA strand. These sequences have a unique property: when transcribed into RNA, they tend to pair with each other and form a stable stem-loop structure. This secondary structure is known as a hairpin loop. In the context of rho-independent termination, the inverted repeat is integral because it signals the end of transcription when the hairpin destabilizes the RNA-DNA hybrid. These structures also cause the RNA polymerase to pause briefly, setting the stage for termination.
Hairpin Structure
A hairpin structure is a physical formation created when the RNA strand folds back on itself due to the presence of complementary inverted repeat sequences. The result is a loop with a double-stranded stem. This structure is significantly stable and can disrupt the normal progression of RNA polymerase along the DNA template. Once the hairpin forms, it causes RNA polymerase to pause, which is a crucial step in rho-independent termination. This pause gives time for the weak poly-U tract to destabilize the RNA-DNA hybrid, facilitating termination.
Poly-U Tract
The poly-U tract is a sequence of uracil nucleotides in the RNA that follows the inverted repeat and hairpin structure. This segment originates from a string of adenine bases on the DNA template. The poly-U tract forms weak hydrogen bonds with the adenines in the DNA. This weakness is critical because it allows the transcript to easily dissociate from the DNA, effectively terminating transcription. Without the poly-U tract, the hairpin structure might not be sufficient to ensure proper termination, as the dissociation would be less likely to occur.
RNA Polymerase
RNA polymerase is the enzyme responsible for synthesizing RNA from a DNA template during transcription. Its main job is to read the DNA strand and assemble the complementary RNA strand. During rho-independent termination, RNA polymerase encounters the hairpin structure created by the inverted repeat and the subsequent poly-U tract. The hairpin causes the polymerase to pause, which, coupled with the weak bonds of the poly-U tract, leads to the release of the RNA transcript. This is how the transcription process is brought to a close without requiring additional proteins, such as the rho factor.
Transcription Termination
Transcription termination is the phase where the synthesis of RNA concludes. In rho-independent termination, this process is primarily facilitated by the formation of a hairpin structure followed by a stretch of uracils. When the RNA polymerase transcribes the inverted repeat, the resulting hairpin causes the enzyme to stall. The presence of the poly-U tract ensures that the newly formed RNA can detach from the DNA template easily. This combination is essential for a successful termination. Without either component, termination might fail, leading to continued transcription, which could result in excessively long RNA molecules that might not function correctly.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

What are the major classes of cellular RNA?

Enhancers are sequences that affect the initiation of the transcription of genes that are hundreds or thousands of nucleotides away. Transcription factors that bind to enhancers usually interact directly with transcription factors at promoters by causing the intervening DNA to loop out. An enhancer of bacteriophage T4 does not function by looping of the DNA (D. R. Herendeen et al. 1992. Science 256:1298-1303). Propose some mechanisms other than DNA looping by which this enhancer might affect transcription at a gene thousands of nucleotides away.

The following sequence of nucleotides is found in a singlestranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\), and which end is 3 '? b. Give the sequence and identify the \(5^{\prime}\) and 3 ' ends of the RNA transcribed from this template.

A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho subunit. At high temperatures, rho is not functional. When these bacteria are raised at elevated temperatures, which of the following effects would you expect to see? Explain your reasoning for accepting or rejecting each of these five options. a. Transcription does not take place. b. All RNA molecules are shorter than normal. c. All RNA molecules are longer than normal. d. Some RNA molecules are longer than normal. e. RNA is copied from both DNA strands.

What is the substrate for RNA synthesis? How is this substrate modified and joined together to produce an RNA molecule?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.