/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 27 Which of the following two molec... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Which of the following two molecules of DNA has the lower melting temperature? Why? AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG AGGCGGGTAGGCACCCTTA TCCGCCCATCCGTGGGAAT

Short Answer

Expert verified
Sequence 1 has the lower melting temperature due to its lower GC content.

Step by step solution

01

Identify the Given DNA Sequences

The exercise provides two linear sequences of DNA: \( \text{Sequence 1: AGTTACTAAAGCAATACATC and TCAATGATTTCGTTATGTAG} \) and \( \text{Sequence 2: AGGCGGGTAGGCACCCTTA and TCCGCCCATCCGTGGGAAT} \). We will assess each sequence to determine which one has a lower melting temperature.
02

Count the GC Content

Count the number of Guanine (G) and Cytosine (C) bases in each sequence, as these bases form three hydrogen bonds with each other, contributing to higher stability and melting temperature. - Sequence 1: Has 8 G and C bases out of a total 20 bases, so the GC content is \(\frac{8}{20} = 40\%\).- Sequence 2: Has 14 G and C bases out of a total 20 bases, so the GC content is \(\frac{14}{20} = 70\%\).
03

Analyze Melting Temperature

The melting temperature ( abla T ext{m}) of a sequence increases with the percentage of GC content because stronger GC bonds require more energy (higher temperature) to break. Sequence 2 has 70% GC content compared to Sequence 1's 40% GC content, indicating Sequence 2 has a higher melting temperature.
04

Determine the Lower Melting Temperature Sequence

Since Sequence 1 has a lower GC content than Sequence 2, Sequence 1 will have a lower melting temperature. Therefore, Sequence 1 compromises double-stranded DNA stability more easily with less heat compared to Sequence 2.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

GC Content
DNA is made up of four different nitrogenous bases: adenine (A), thymine (T), guanine (G), and cytosine (C). The GC content refers to the percentage of nitrogenous bases in a DNA molecule that are either guanine (G) or cytosine (C). This content is crucial because:
  • Guanine and cytosine bases are stronger bonded than adenine and thymine because they form three hydrogen bonds, compared to the two bonds between adenine and thymine.
  • The higher the GC content, the more stable the DNA strand is as a whole.
  • It affects the 'melting temperature' of the DNA, which is the temperature at which the two strands of the DNA molecule separate.
For example, among the sequences given, Sequence 1 has a GC content of 40%, while Sequence 2 has a much higher GC content of 70%. This means Sequence 2 is more stable and will have a higher melting temperature.
Double-Stranded DNA Stability
The stability of double-stranded DNA is significantly influenced by its nucleotide composition, particularly the GC content. Stability in this context refers to how tightly the two strands of the DNA molecule are held together. Here are reasons why GC-rich strands are typically more stable:
  • G-C pairs form three hydrogen bonds, compared to the two hydrogen bonds in A-T pairs.
  • More bonds mean more energy is required to break DNA apart, leading to higher stability.
  • High GC content can also affect the structural integrity of the DNA, making it less prone to denaturation.
In the context of the given sequences, Sequence 1 is less stable due to its lower GC content of 40%, while Sequence 2, with a higher 70% GC content, showcases increased stability.
Hydrogen Bonds
Hydrogen bonds play a critical role in the structure and function of DNA. They are the forces that hold the two strands of the DNA double helix together. Each base pair is held together by hydrogen bonds, making them crucial for DNA's stability and properties:
  • G-C pairs are bonded by three hydrogen bonds, leading to stronger and more stable interactions.
  • A-T pairs, on the other hand, are connected by only two hydrogen bonds, resulting in a slightly weaker connection.
  • The number of hydrogen bonds directly influences the melting temperature of DNA, where strands with more G-C pairs (more hydrogen bonds) will have a higher melting temperature.
Considering this, in the given example, Sequence 2 possesses a greater number of hydrogen bonds due to its higher GC content, rendering it more stable and with a higher melting temperature compared to Sequence 1.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.