Chapter 11: Problem 27
Which of the following two molecules of DNA has the lower melting temperature? Why? AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG AGGCGGGTAGGCACCCTTA TCCGCCCATCCGTGGGAAT
Short Answer
Expert verified
Sequence 1 has the lower melting temperature due to its lower GC content.
Step by step solution
01
Identify the Given DNA Sequences
The exercise provides two linear sequences of DNA: \( \text{Sequence 1: AGTTACTAAAGCAATACATC and TCAATGATTTCGTTATGTAG} \) and \( \text{Sequence 2: AGGCGGGTAGGCACCCTTA and TCCGCCCATCCGTGGGAAT} \). We will assess each sequence to determine which one has a lower melting temperature.
02
Count the GC Content
Count the number of Guanine (G) and Cytosine (C) bases in each sequence, as these bases form three hydrogen bonds with each other, contributing to higher stability and melting temperature. - Sequence 1: Has 8 G and C bases out of a total 20 bases, so the GC content is \(\frac{8}{20} = 40\%\).- Sequence 2: Has 14 G and C bases out of a total 20 bases, so the GC content is \(\frac{14}{20} = 70\%\).
03
Analyze Melting Temperature
The melting temperature (
abla T ext{m}) of a sequence increases with the percentage of GC content because stronger GC bonds require more energy (higher temperature) to break. Sequence 2 has 70% GC content compared to Sequence 1's 40% GC content, indicating Sequence 2 has a higher melting temperature.
04
Determine the Lower Melting Temperature Sequence
Since Sequence 1 has a lower GC content than Sequence 2, Sequence 1 will have a lower melting temperature. Therefore, Sequence 1 compromises double-stranded DNA stability more easily with less heat compared to Sequence 2.
Unlock Step-by-Step Solutions & Ace Your Exams!
-
Full Textbook Solutions
Get detailed explanations and key concepts
-
Unlimited Al creation
Al flashcards, explanations, exams and more...
-
Ads-free access
To over 500 millions flashcards
-
Money-back guarantee
We refund you if you fail your exam.
Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
GC Content
DNA is made up of four different nitrogenous bases: adenine (A), thymine (T), guanine (G), and cytosine (C). The GC content refers to the percentage of nitrogenous bases in a DNA molecule that are either guanine (G) or cytosine (C). This content is crucial because:
- Guanine and cytosine bases are stronger bonded than adenine and thymine because they form three hydrogen bonds, compared to the two bonds between adenine and thymine.
- The higher the GC content, the more stable the DNA strand is as a whole.
- It affects the 'melting temperature' of the DNA, which is the temperature at which the two strands of the DNA molecule separate.
Double-Stranded DNA Stability
The stability of double-stranded DNA is significantly influenced by its nucleotide composition, particularly the GC content. Stability in this context refers to how tightly the two strands of the DNA molecule are held together. Here are reasons why GC-rich strands are typically more stable:
- G-C pairs form three hydrogen bonds, compared to the two hydrogen bonds in A-T pairs.
- More bonds mean more energy is required to break DNA apart, leading to higher stability.
- High GC content can also affect the structural integrity of the DNA, making it less prone to denaturation.
Hydrogen Bonds
Hydrogen bonds play a critical role in the structure and function of DNA. They are the forces that hold the two strands of the DNA double helix together. Each base pair is held together by hydrogen bonds, making them crucial for DNA's stability and properties:
- G-C pairs are bonded by three hydrogen bonds, leading to stronger and more stable interactions.
- A-T pairs, on the other hand, are connected by only two hydrogen bonds, resulting in a slightly weaker connection.
- The number of hydrogen bonds directly influences the melting temperature of DNA, where strands with more G-C pairs (more hydrogen bonds) will have a higher melting temperature.