/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 22 A diploid human cell contains ap... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A diploid human cell contains approximately 6.4 billion base pairs of DNA. a. How many nucleosomes are present in such a cell? (Assume that the linker DNA encompasses \(40 \mathrm{bp} .)\) b. How many histone proteins are complexed with this DNA?

Short Answer

Expert verified
There are about 34,408,602 nucleosomes and 275,268,816 histone proteins in a diploid human cell.

Step by step solution

01

Calculate total DNA length

A diploid human cell contains approximately 6.4 billion base pairs (bp) of DNA. This will be the starting point to determine how many nucleosomes are present, given the number of base pairs where a single nucleosome is found.
02

Determine nucleosome structure

Each nucleosome contains about 146 bp of DNA wrapped around a histone core, with an additional 40 bp of linker DNA connecting to the next nucleosome, totaling 186 bp per nucleosome unit.
03

Calculate number of nucleosomes

Divide the total number of base pairs by the number of base pairs per nucleosome: \(6.4\text{ billion bp} \div 186 \text{ bp/nucleosome}\) to get the number of nucleosomes. This equals approximately \(34,408,602.15\), which we round to \(34,408,602\).
04

Determine histone proteins per nucleosome

Each nucleosome consists of 8 histone proteins (two each of the histones H2A, H2B, H3, and H4).
05

Calculate total number of histone proteins

Multiply the number of nucleosomes by the number of histones per nucleosome: \(34,408,602 \times 8 = 275,268,816\) histone proteins.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Diploid Human Cell
A diploid human cell is a type of cell that contains two complete sets of chromosomes. Most humans are diploid organisms, meaning each of their cells contains two sets of 23 chromosomes, one inherited from each parent. These chromosomes carry the genetic information necessary for the development, functioning, and reproduction of the organism. In humans, the total number of chromosomes in a diploid cell is 46. Diploid cells are crucial for sexual reproduction because they ensure that offspring receive genetic material from both parents. During the formation of gametes (sperm and egg cells), these cells undergo a special division called meiosis, which reduces the chromosome number by half, resulting in haploid cells. When two haploid gametes fuse during fertilization, they restore the diploid state in the next generation. Understanding diploid cells is essential for comprehending the basics of human genetics and inheritance. By investigating diploid cells, scientists can explore genetic diversity and the mechanisms behind various hereditary conditions.
Base Pairs
Base pairs are the building blocks of the DNA double helix structure. Each base pair consists of two chemical bases bonded to each other. In DNA, the bases are adenine (A), thymine (T), cytosine (C), and guanine (G). These bases pair specifically: adenine with thymine, and cytosine with guanine. This is known as complementary base pairing. - Base pairs connect the two strands of DNA, forming the classic ladder shape of the double helix. - The specific sequences of base pairs encode genetic information, read in units called genes. - In a diploid human cell, there are approximately 6.4 billion base pairs, making up the vast amount of genetic information. The number of base pairs is crucial in calculating how many nucleosomes are required to fit all that DNA inside the cell's nucleus. Each section of DNA must be tightly packed and organized to ensure proper cell function and regulation.
Histone Proteins
Histone proteins are fundamental components of chromatin, the substance within the nucleus that contains DNA. These proteins help package DNA into a compact, dense form, allowing it to fit within the nucleus of a cell. - Each nucleosome is formed by wrapping 146 base pairs of DNA around a core of histone proteins. - A histone core is made up of eight proteins: two each of H2A, H2B, H3, and H4. - The histone tails can undergo various chemical modifications, influencing gene expression by either loosening or tightening the DNA they wrap. Histone proteins play a critical role in gene regulation. By controlling how tightly DNA is wound on nucleosomes, histones influence whether genes are accessible for transcription or remain silent. This regulation is essential for cellular function and differentiation. Understanding histones is key to unlocking the secrets of epigenetics, a field that explores how gene expression is regulated without altering the underlying DNA sequence.
DNA Structure
DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions of organisms. Its structure is famously known as a double helix, which resembles a twisted ladder. - The DNA double helix consists of two strands made from a sugar-phosphate backbone and paired nitrogenous bases. - The strands run in opposite directions, a feature known as antiparallel orientation. - It is the sequence of base pairs along the DNA that encodes genetic information. DNA's structure is not only impressive for its complexity but also for its simplicity when it comes to duplication. Each strand can serve as a template for replicating the sequence of bases, allowing for faithful copying of genetic information during cell division. Packing this long DNA into the nucleus is possible because DNA wraps around histone proteins, forming nucleosomes. This efficient packing ensures that DNA is both protected and organized within the cell, ready to be accessed whenever needed for gene expression or replication.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Describe the composition and structure of the nucleosome.

Antibiotics such as chloramphenicol, tetracycline, and erythromycin inhibit protein synthesis in bacteria but have no effect on the synthesis of proteins encoded by eukaryotic nuclear genes (see Section 15.4 in Chapter 15 for a discussion of the effects of antibiotics on protein synthesis). Cycloheximide inhibits the synthesis of proteins encoded by nuclear genes but has no effect on bacterial protein synthesis. How might these compounds be used to determine which proteins are encoded by mitochondrial and chloroplast genomes?

In a study of a muscle disorder, several affected families exhibited vision problems, muscle weakness, and deafness (M. Zeviani et al. 1990. American Journal of Human Genetics \(47: 904-914\) ). Analysis of the mtDNA from affected members of these families revealed that large numbers of their mtDNA molecules possessed deletions of varying lengths. Different members of the same family and even different mitochondria from the same person possessed deletions of different sizes, so the underlying defect appeared to be a tendency for the \(\mathrm{mtDNA}\) of affected persons to have deletions. A pedigree of one of the families studied is shown below (see Chapter 6 for a discussion of how to read and interpret pedigrees). The researchers concluded that this disorder is inherited as an autosomal dominant trait, and they mapped the disease-causing gene to a position on chromosome 10 in the nucleus. a. What characteristics of the pedigree rule out inheritance of a trait encoded by a gene in the \(\mathrm{mtDNA}\) as the cause of this disorder? b. Explain how a mutation in a nuclear gene might lead to deletions in mtDNA.

What would be the likely consequences of a large deletion in the gene that encoded CENP-A, so that no functional CENP-A was produced?

Which of the following two molecules of DNA has the lower melting temperature? Why? AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG AGGCGGGTAGGCACCCTTA TCCGCCCATCCGTGGGAAT

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.