/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 2 What functions does supercoiling... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

What functions does supercoiling serve for the cell?

Short Answer

Expert verified
Supercoiling helps in DNA packaging, regulating accessibility, and providing stability.

Step by step solution

01

Understanding Supercoiling

Supercoiling refers to the over-winding or under-winding of a DNA strand, and it occurs when the DNA helix is subjected to strain by twisting. This alters the topology of DNA and is essential in maintaining DNA stability and function within cells.
02

DNA Packing Structure

In eukaryotic cells, DNA is supercoiled to help it fit into the nucleus. Supercoiling compacts the DNA, allowing long genomic DNA to be stored efficiently in tight spaces within the cell.
03

Regulation of DNA Accessibility

Supercoiling affects the accessibility of DNA for replication and transcription. Regions of DNA can become more or less accessible to replication and transcription machinery based on their supercoiled state, hence regulating gene expression.
04

Protection and Stability

Supercoiling provides protection to the DNA strands from damage. The densely packed supercoiled DNA structure offers resistance to physical and enzymatic damage.
05

Maintaining Negative Supercoiling

Negative supercoiling helps to store energy in the DNA. This energy can be used to assist various DNA transactions like unwinding during replication or transcription.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA topology
DNA topology describes the three-dimensional arrangement of the DNA strands within the cell. It includes how the strands are coiled and how these coils interact with each other. Supercoiling is a key aspect of DNA topology, where the DNA helix is twisted beyond its usual relaxed state. This supercoiling can result in either tighter winding (positive supercoils) or looser winding (negative supercoils).
  • Positive supercoiling can occur during processes like DNA replication and transcription, where certain regions need to be opened temporarily to allow machinery to access necessary genetic information.
  • Negative supercoiling, on the other hand, aids in packaging DNA into the confined space of the cell nucleus.
Topological states are crucial for the efficient management of genetic information, affecting how DNA is compacted and accessed within cells.
gene expression regulation
Gene expression regulation refers to the control of the timing and amount of a gene's transcription and translation into proteins. Supercoiling plays a significant role in this process by controlling the accessibility of DNA.
  • DNA regions that are tightly supercoiled are less accessible to transcription factors and RNA polymerases, leading to reduced gene expression.
  • Conversely, areas of the genome that are more relaxed, or negatively supercoiled, are more accessible and thus more actively transcribed.
This dynamic accessibility allows cells to quickly respond to environmental changes by modulating which genes are turned on or off, ensuring that proteins are produced only when needed.
DNA stability
DNA stability concerns the structural integrity and preservation of the DNA sequence over time. Supercoiling contributes to DNA stability by protecting the strands from breakage and damage.
  • When DNA is supercoiled, it is less susceptible to physical forces that could otherwise lead to strand breaks.
  • Additionally, enzymes that could degrade DNA have reduced access to tightly coiled regions, providing an extra layer of protection.
Supercoiling also helps prevent the formation of knots and tangles in the DNA strands, which could disrupt cell function and DNA replication processes.
nuclear DNA packaging
Nuclear DNA packaging involves the organization of DNA within the cellular nucleus, ensuring that a large amount of genetic material is compactly stored yet accessible when needed. Supercoiling is integral to this packaging process, allowing vast lengths of DNA to be condensed into small nuclear spaces without losing function.
  • The compacted form of DNA, aided by supercoiling, is organized into structures called nucleosomes, and further into higher-order chromatin structures.
  • This organization not only saves space but also regulates access to DNA during processes such as replication and transcription.
Efficient DNA packaging ensures that the genetic blueprint is maintained intact, ready to be replicated and passed on during cell division.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Describe the composition and structure of the nucleosome.

In 1979 , bones found outside Ekaterinburg, Russia, were shown to be those of Tsar Nicholas and his family, who were executed in 1918 by a Bolshevik firing squad in the Russian Revolution (see the introduction to Chapter 14 ). To prove that the skeletons were those of the royal family, mtDNA was extracted from the bone samples, amplified by PCR, and compared with mtDNA from living relatives of the tsar's family. a. Why was DNA from the mitochondria analyzed instead of nuclear DNA? What are some of the advantages of using mtDNA for this type of study? b. Mitochondrial DNA from which living relatives would provide useful information for verifying that the skeletons were those of the royal family?

Which of the following two molecules of DNA has the lower melting temperature? Why? AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG AGGCGGGTAGGCACCCTTA TCCGCCCATCCGTGGGAAT

What is meant by the term \(promiscuous\) DNA?

An explorer discovers a strange new species of plant and sends some of the plant tissue to a geneticist to study. The geneticist isolates chromatin from the plant and examines it with an electron microscope. She observes what appear to be beads on a string. She then adds a small amount of nuclease, which cleaves the string into individual beads that each contain 280 bp of DNA. After digestion with more nuclease, a 120 -bp fragment of DNA remains attached to a core of histone proteins. Analysis of the histone core reveals histones in the following proportions: $$ \begin{array}{lc} \mathrm{H} 1 & 12.5 \% \\ \mathrm{H} 2 \mathrm{~A} & 25 \% \\ \mathrm{H} 2 \mathrm{~B} & 25 \% \\ \mathrm{H} 3 & 0 \% \\ \mathrm{H} 4 & 25 \% \\ \mathrm{H} 7(\text { a new histone }) & 12.5 \% \end{array} $$ On the basis of these observations, what conclusions could the geneticist make about the probable structure of the nucleosome in the chromatin of this plant?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.