/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 21 How do epigenetic traits differ ... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 21: Problem 21

How do epigenetic traits differ from traditional genetic traits, such as the differences in the color and shape of peas that Mendel studied?

Short Answer

Expert verified
Epigenetic traits involve gene expression changes without altering DNA sequences, while traditional traits involve actual DNA sequence changes that determine traits.

Step by step solution

01

Understand Traditional Genetic Traits

Traditional genetic traits are inherited through changes in DNA sequence. Mendel's peas, for example, showed variations in color and shape due to different alleles (versions of a gene) found on the chromosomes, which directly determined these traits.
02

Define Epigenetic Traits

Epigenetic traits result from modifications that affect gene expression without altering the DNA sequence. These include changes such as DNA methylation or histone modification, which can turn genes on or off, influencing traits that may be passed to the next generation.
03

Compare Gene Expression and DNA Sequence Alterations

Traditional genetic traits depend on the presence of specific alleles, or actual changes in DNA sequence, to express certain characteristics. In contrast, epigenetic traits involve regulatory factors that modify the behavior of existing genetic material, potentially altering trait expression.
04

Explore Mechanism Reversibility and Environment Influence

Epigenetic changes are often reversible and can be influenced by environmental factors. In comparison, traditional genetic changes are permanent once they occur in the DNA sequence and are less likely to be influenced by the environment.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Genetic Traits
Genetic traits are the characteristics or features of an organism that are inherited from one generation to the next. These traits are determined by the sequence of DNA within the genes. In the context of Mendel's experiments with peas, genetic traits such as the color and shape of the peas were determined by different alleles 鈥� alternative forms of a gene 鈥� found on chromosomes.

For example, a pea plant might have one allele for green color and another for yellow color. The combination of these alleles determines the pea's final color, showcasing how genetic information is passed down through generations.
  • Genetic traits are stable because they are encoded in the DNA sequence.
  • They are expressed when specific alleles are present.
  • Environment usually has minimal influence on these traits.
DNA Methylation
DNA methylation is an important epigenetic modification where a methyl group is added to the DNA molecule. This modification typically occurs at the cytosine base of DNA, often in the context of CpG islands (regions with a high frequency of cytosine followed by guanine).

DNA methylation can silence genes, meaning it can turn off a gene鈥檚 ability to be transcribed, thereby blocking protein production that the gene codes for. This process affects how genes are expressed without changing the actual DNA sequence. Some key points:
  • It is involved in normal cellular processes such as embryonic development and X-chromosome inactivation.
  • Methylation patterns can change in response to environmental factors, which can then affect gene expression.
  • Abnormal methylation is linked to diseases such as cancer.
Gene Expression
Gene expression is the process by which genetic instructions are used to synthesize gene products, like proteins, which perform essential functions in the body.

This process is regulated at multiple levels, from the transcription of DNA to mRNA, to the translation of mRNA into proteins. Gene expression determines how cells function and respond to their environment, and abnormal expression patterns can lead to diseases. Understanding gene expression involves:
  • Transcription: copying DNA to mRNA.
  • Translation: converting mRNA into protein.
  • Regulation: ensuring proteins are made at the right time and place.
Alterations in this finely tuned process, such as those influenced by epigenetic factors like DNA methylation, can significantly impact organism development and health.
Mendelian Inheritance
Mendelian inheritance refers to the set of rules about how traits pass down from parents to offspring, discovered by Gregor Mendel in the 19th century through his work with pea plants. It relies on the transmission of alleles that can be dominant or recessive.

Mendel鈥檚 laws of inheritance include:
  • Law of Segregation: Each organism carries two alleles for each trait, but only passes one allele to its offspring.
  • Law of Independent Assortment: Genes for different traits are passed to offspring independently of one another.
  • Genes and traits are directly influenced by the specific alleles involved.
Mendelian inheritance is foundational in understanding how genetic traits are passed through generations. Unlike epigenetic changes, these genetic changes are usually permanent and remain stable across environments.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment and indicate the locations of methylated cytosines. Sequence without treatment: \(\quad\) AATTGCCCGATCGATTAAGCCA Sequence with treatment: \(\quad\) AATTGTTTGATCGATTAAGCTA

What is the major form of DNA methylation that is seen in eukaryotes? At what type of DNA sequence is DNA methylation usually found?

What types of histone modifications are responsible for epigenetic phenotypes?

Much of DNA methylation in eukaryotes occurs at CpG dinucleotides, but some individual cytosine nucleotides are also methylated to form 5 methylcytosine. Considering what you know about the process by which DNA methylation at CpG dinucleotides is maintained across cell division, do you think that methylation at individual C nucleotides would also be maintained by the same process? Explain your reasoning.

In recent years, techniques have been developed to clone mammals through a process called nuclear transfer, in which the nucleus of a somatic cell is transferred to an egg cell from which the nuclear material has been removed (see Chapter 22 ). Research has demonstrated that when a nucleus from a differentiated somatic cell is transferred to an eggcell, only a small percentage of the resulting embryos complete development, and many of those that do die shortly after birth. In contrast, when a nucleus from an undifferentiated embryonic stem cell is transferred to an egg cell, the percentage of embryos that complete development is significantly higher (W. M. Rideout, K. Eggan, and R. Jaenisch. 2001. Science 293:1095-1098). Propose a possible reason for why a higher percentage of cloned embryos develop successfully when the nucleus transferred comes from an undifferentiated embryonic stem cell.
See all solutions

Recommended explanations on Biology Textbooks

Biological Molecules

Read Explanation

Reproduction

Read Explanation

Control of Gene Expression

Read Explanation

Microbiology

Read Explanation

Energy Transfers

Read Explanation

Substance Exchange

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.