/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 32 A geneticist is interested in de... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment and indicate the locations of methylated cytosines. Sequence without treatment: \(\quad\) AATTGCCCGATCGATTAAGCCA Sequence with treatment: \(\quad\) AATTGTTTGATCGATTAAGCTA

Short Answer

Expert verified
The original DNA is AATTGCCCGATCGATTAAGCCA with methylated cytosines at positions 3, 6, 9, 12, and 20.

Step by step solution

01

Understand the Effect of Sodium Bisulfite Treatment

Sodium bisulfite treatment of DNA deaminates cytosine, converting it into uracil. However, methylated cytosines are resistant to this conversion and remain as cytosine. In subsequent sequencing, uracil is read as thymine, while cytosine remains as cytosine if it was methylated.
02

Compare the Sequences

Compare the untreated sequence with the treated sequence. The untreated sequence is AATTGCCCGATCGATTAAGCCA, while the treated sequence is AATTGTTTGATCGATTAAGCTA. Identify the positions where there is C in the untreated sequence and a T in the treated sequence. These indicate the positions of non-methylated cytosines that were converted to uracil and read as thymine.
03

Identify Methylated Cytosines

Identify positions where there is a cytosine in the untreated sequence and a cytosine in the treated sequence. These are the methylated cytosines since they resisted conversion. From our sequences, compare each position: the second position (G→T) indicates the third and sixth positions where methylation was absent and conversion occurred. The ninth, twelfth, and twentieth positions were unchanged indicating they are methylated.
04

Provide Original DNA Sequence

The original sequence of DNA remains as AATTGCCCGATCGATTAAGCCA. The methylated cytosines are at positions 3, 6, 9, 12, and 20 since these positions resisted the sodium bisulfite treatment. Thus, in this context, C at positions 3, 6, and 9 remain after sodium bisulfite treatment.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Sodium Bisulfite Treatment
Sodium bisulfite treatment is a technique used to help identify methylated cytosines in DNA. When you treat DNA with sodium bisulfite, it specifically changes unmethylated cytosine into uracil. In contrast, methylated cytosines remain unaltered and stay as cytosine. This selective modification is incredibly useful in genetic studies. By differentiating between methylated and unmethylated cytosines, researchers can better understand gene expression patterns.
  • Unmethylated cytosine âžœ Converted to uracil
  • Methylated cytosine âžœ Remains cytosine

When the treated DNA is sequenced, the uracil is read as thymine, allowing scientists to deduce which cytosines were methylated. Through this method, sodium bisulfite treatment essentially "marks" the DNA based on methylation, facilitating detailed genetic analysis.
Methylated Cytosines
Methylated cytosines are cytosine bases in DNA that have a methyl group (-CH₃) attached. This methyl group is vital because it affects how genes are expressed without changing the actual DNA sequence. Methylated cytosines often occur in areas of the genome known as CpG islands. These regions are rich in cytosine and guanine stretches, and methylation here can silence genes.
  • Presence of a methyl group âžœ Methylated cytosine
  • Occurs at CpG islands

Methylation serves as a regulatory mechanism for turning genes on or off, playing a significant role in development, aging, and even disease. For example, abnormal methylation patterns are linked to cancer, as they can erroneously turn off tumor suppressor genes. Detecting methylated cytosines via methods like sodium bisulfite treatment is crucial for understanding these complex processes.
DNA Sequencing
DNA sequencing is the process of determining the precise order of nucleotides within a DNA molecule. Through sequencing, scientists can read the genetic information that guides an organism's development, function, and reproduction. In the context of sodium bisulfite treatment, sequencing reveals changes in the DNA that indicate which cytosines are methylated.
  • Determines nucleotide order
  • Identifies genetic information

The process involves breaking down the DNA into manageable fragments, amplifying specific pieces, and using chemical reactions to identify the sequence. Sequencing treated DNA shows where cytosines remained, indicating methylation resistance. By analyzing the differences between treated and untreated sequences, researchers gain insights into methylation patterns critical for genetic analysis.
Genetic Analysis
Genetic analysis refers to the techniques and processes used to study genes and their functions. This analysis can reveal how genes interact, the hereditary transmission of genes, and the role of environmental factors in gene expression. Tools like sodium bisulfite treatment help identify important epigenetic markers such as methylated cytosines, which influence gene activity.
  • Studies gene functions and interactions
  • Evaluates hereditary patterns
  • Assesses environmental impact on genes

By understanding methylation patterns through genetic analysis, scientists can determine key genetic triggers for various conditions. This analysis is instrumental in developing targeted treatments, especially in complex diseases like cancer. In summary, genetic analysis not only decodes the genetic blueprint but also unveils how these codes are regulated and modified by methylation processes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.