/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 12 Give an example of an epigenetic... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Give an example of an epigenetic effect of diet on metabolism.

Short Answer

Expert verified
A high-fat diet can cause DNA methylation changes, affecting genes related to metabolism and increasing the risk of obesity and diabetes.

Step by step solution

01

Understand Epigenetics

Epigenetics refers to changes in gene expression that do not involve alterations to the underlying DNA sequence. These changes can be influenced by various factors, including diet, and can affect how genes are turned on or off.
02

Identify Diet's Role

Diet can influence epigenetic markers, such as DNA methylation and histone modification. These markers can alter how genes related to metabolism are expressed, leading to changes in metabolic processes.
03

Connect Diet to Metabolism

An example of diet affecting metabolism via epigenetic changes is the consumption of high-fat diets that can lead to DNA methylation changes in genes. These changes may predispose individuals to metabolic disorders like obesity and type 2 diabetes.
04

Example Explanation

In individuals consuming a high-fat diet, genes associated with fat storage and insulin regulation can become hypermethylated. This hypermethylation can reduce the expression of these genes, leading to impaired metabolism and an increased risk of metabolic diseases.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA methylation
DNA methylation is an epigenetic mechanism where a methyl group attaches to the DNA molecule, typically at cytosine bases that are followed by guanine bases (known as CpG sites). This addition can change the activity of a DNA segment without changing the sequence. By modifying gene expression, DNA methylation can switch genes off, preventing them from carrying out their usual functions.

In the context of diet, high-fat diets have been shown to cause methylation changes in genes that are important for regulating metabolism. For instance, a high-fat diet can lead to the methylation of genes responsible for insulin sensitivity and fat metabolism. The result is often a reduction in the activity of these genes, potentially leading to the development of metabolic disorders such as obesity or type 2 diabetes.
Histone modification
Histone modification is another form of epigenetic change. Histones are proteins around which DNA is wrapped, and they play a key role in packaging DNA into the microscopic space in the nucleus. Specific chemical modifications like methylation or acetylation of the histone proteins can affect how tightly DNA is wound around them.

Diet influences these modifications. For example, the components of a high-fat diet can impact histone acetylation, leading to either activation or repression of gene expression. Alterations in histone modifications can result in changes to the way metabolic genes are expressed, potentially affecting metabolic balance and contributing to diseases such as obesity and other metabolic syndromes.
Metabolic disorders
Metabolic disorders refer to conditions that disrupt normal metabolism, the process your body uses to get or make energy from the food you eat. These disorders can be a result of both genetic and epigenetic factors.

Epigenetic changes like DNA methylation and histone modification can lead to abnormal gene expression patterns in metabolic pathways. For instance, dysregulation of genes involved in insulin action, energy balance, and lipid metabolism due to epigenetic alterations is common in metabolic disorders. A high-fat diet poor in essential nutrients can accelerate these epigenetic changes, increasing susceptibility to metabolic diseases like obesity, insulin resistance, and type 2 diabetes.
Gene expression
Gene expression is the process by which the instructions in our DNA are converted into a functional product, such as a protein. Epigenetic mechanisms such as DNA methylation and histone modification play critical roles in regulating gene expression.

In high-fat diets, the alteration of gene expression is a significant concern. These diets may lead to hypermethylation or altered histone modification, which can suppress the normal function of genes involved in metabolism. Such suppression could lead to reduced breakdown of fats and sugars, contributing further to metabolic imbalances and disorders.
High-fat diet effects
A high-fat diet is rich in calories and fats, and it can have numerous effects on the body, particularly influencing epigenetic markers. Such a diet has been shown to trigger epigenetic changes that affect the expression of metabolic genes.

Long-term consumption of high-fat diets can cause DNA methylation changes and histone modifications that downregulate genes responsible for proper metabolic functions like energy consumption and fat oxidation. This type of diet-induced epigenetic alteration is a risk factor for developing metabolic disorders, including obesity. Additionally, these changes can be hereditary, potentially affecting future generations.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Define genomic imprinting.

What evidence suggests that differences in monozygotic twins may be caused by epigenetic effects?

What is the thrifty phenotype hypothesis? How does it help to explain the long-term effects of famine on people conceived during the Dutch Hunger Winter?

A geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment and indicate the locations of methylated cytosines. Sequence without treatment: \(\quad\) AATTGCCCGATCGATTAAGCCA Sequence with treatment: \(\quad\) AATTGTTTGATCGATTAAGCTA

In recent years, techniques have been developed to clone mammals through a process called nuclear transfer, in which the nucleus of a somatic cell is transferred to an egg cell from which the nuclear material has been removed (see Chapter 22 ). Research has demonstrated that when a nucleus from a differentiated somatic cell is transferred to an eggcell, only a small percentage of the resulting embryos complete development, and many of those that do die shortly after birth. In contrast, when a nucleus from an undifferentiated embryonic stem cell is transferred to an egg cell, the percentage of embryos that complete development is significantly higher (W. M. Rideout, K. Eggan, and R. Jaenisch. 2001. Science 293:1095-1098). Propose a possible reason for why a higher percentage of cloned embryos develop successfully when the nucleus transferred comes from an undifferentiated embryonic stem cell.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.