/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Genetics: A Conceptual Approach Chapter 21 - (Page 3) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 27

A scientist does an experiment in which she removes the offspring of rats from their mother at birth and has her genetics students feed and rear the offspring. Assuming that the students do not lick and groom the baby rats as the mother rats normally do, what long-term behavioral and epigenetic effects would you expect to see in the rats when they grow up?

Problem 32

A geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. She treats some copies of the fragment with sodium bisulfite and leaves some copies untreated. She then sequences the treated and untreated copies of the fragment and obtains the following results. Give the original sequence of the DNA fragment and indicate the locations of methylated cytosines. Sequence without treatment: \(\quad\) AATTGCCCGATCGATTAAGCCA Sequence with treatment: \(\quad\) AATTGTTTGATCGATTAAGCTA

Problem 34

In recent years, techniques have been developed to clone mammals through a process called nuclear transfer, in which the nucleus of a somatic cell is transferred to an egg cell from which the nuclear material has been removed (see Chapter 22 ). Research has demonstrated that when a nucleus from a differentiated somatic cell is transferred to an eggcell, only a small percentage of the resulting embryos complete development, and many of those that do die shortly after birth. In contrast, when a nucleus from an undifferentiated embryonic stem cell is transferred to an egg cell, the percentage of embryos that complete development is significantly higher (W. M. Rideout, K. Eggan, and R. Jaenisch. 2001. Science 293:1095-1098). Propose a possible reason for why a higher percentage of cloned embryos develop successfully when the nucleus transferred comes from an undifferentiated embryonic stem cell.

Problem 35

The use of embryonic stem cells has been proposed for replacing cells that are destroyed by disease or injury. Because of ethical concerns about creating and destroying embryos to produce embryonic stem cells, researchers have attempted to create induced pluripotent stem cells (iPSCs). In this chapter, we discussed studies showing that iPSCs retain some epigenetic marks from the differentiated adult cells from which they were derived. What implications might this research have for attempts to use iPSCs to regrow cells and tissues?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks