/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Q.20 Discuss how degeneracy of the ge... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 15: Q.20 (page 392)

Discuss how degeneracy of the genetic code makes cells more robust to mutations.

Short Answer

Expert verified

Degeneracy is believed to be a cellular mechanism toreduce the negative impact of random mutations.

Step by step solution

01

Step1. Introduction

Degeneracy or redundancy of codons is the redundancy of the genetic code, exhibited as the multiplicity of three-base pair codon combinations that specify an amino acid.

The degeneracy of the genetic code is what accounts for the existence of synonymous mutations.

02

Step2. Explanation

Codons that specify the same amino acid typically only differ by one nucleotide. In addition, amino acids with chemically similar side chains are encoded by similar codons.

This nuance of the genetic code ensures that a single-nucleotide substitution mutation might either specify the same amino acid and have no effect, or may specify a similar amino acid, preventing the protein from being rendered completely nonfunctional.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The -10 and -35 regions of prokaryotic promoters are called consensus sequences because ________.

a. they are identical in all bacterial species b. they are similar in all bacterial species

c. they exist in all organisms

d. they have the same function in all organisms

Figure 15.13 Errors in splicing are implicated in cancers and other human diseases. What kinds of mutations might lead to splicing errors? Think of different possible outcomes if splicing errors occur.

A fragment of bacterial DNA reads: 3鈥� 鈥揟ACCTATAATCTCAATTGATAGAAGCACTCTAC鈥� 5鈥� Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

A scientist identifies a pre-mRNA with the following structure.

What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5鈥� cap and 3鈥� polyA tail? a. 220bp b. 295bp c. 140bp d. 435bp.

Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.
See all solutions

Recommended explanations on Biology Textbooks

Reproduction

Read Explanation

Cell Cycle

Read Explanation

Organ Systems

Read Explanation

Biological Molecules

Read Explanation

Control of Gene Expression

Read Explanation

Cellular Energetics

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.