Chapter 21: Problem 9
TATA-less promoters do not contain a recognizable TATA box but are still associated with TBP. What features are often found in these promoters?
/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none}
Learning Materials
Features
Discover
Chapter 21: Problem 9
TATA-less promoters do not contain a recognizable TATA box but are still associated with TBP. What features are often found in these promoters?
All the tools & learning materials you need for study success - in one app.
Get started for free
How does the mechanism of group I introns differ from that of group II introns? Which is more similar to the spliceosome-catalyzed reaction?
The DNA sequence of a gene follows. If this is the sense strand, write the sequence of the mRNA transcript formed. CGCGGATCCTTGAATTCTAAATAAACCATTT ACCACCATGACC
What feature of rRNA makes co-transcriptional folding necessary for correct assembly of the ribosome? How do ribosomal proteins contribute to the formation of the conserved secondary structure of rRNA?
Why is the phosphorylation state of the RNA polymerase II CTD an important component of transcription? Describe the changes that the CTD undergoes from initiation to termination.
Explain why decapping and deadenylation are common mechanisms involved in RNA decay.
What do you think about this solution?
We value your feedback to improve our textbook solutions.