Chapter 21: Problem 4
What feature of rRNA makes co-transcriptional folding necessary for correct assembly of the ribosome? How do ribosomal proteins contribute to the formation of the conserved secondary structure of rRNA?
/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none}
Learning Materials
Features
Discover
Chapter 21: Problem 4
What feature of rRNA makes co-transcriptional folding necessary for correct assembly of the ribosome? How do ribosomal proteins contribute to the formation of the conserved secondary structure of rRNA?
All the tools & learning materials you need for study success - in one app.
Get started for free
Compare and contrast Rho-dependent and Rhoindependent termination. What is a common feature in both mechanisms?
How does the mechanism of group I introns differ from that of group II introns? Which is more similar to the spliceosome-catalyzed reaction?
Why is it beneficial for organisms to have more than one copy of rRNA genes in the genome? Why do more complex organisms tend to have more copies of these genes?
How does the existence of ribozymes like the hammerhead ribozyme and group I introns provide support for the RNA world hypothesis?
The DNA sequence of a gene follows. If this is the sense strand, write the sequence of the mRNA transcript formed. CGCGGATCCTTGAATTCTAAATAAACCATTT ACCACCATGACC
What do you think about this solution?
We value your feedback to improve our textbook solutions.