Chapter 21: Problem 7
Why is \(\mathrm{Mg}^{2+}\) essential for the activity of RNA polymerase?
/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none}
Learning Materials
Features
Discover
Chapter 21: Problem 7
Why is \(\mathrm{Mg}^{2+}\) essential for the activity of RNA polymerase?
All the tools & learning materials you need for study success - in one app.
Get started for free
The DNA sequence of a gene follows. If this is the sense strand, write the sequence of the mRNA transcript formed. CGCGGATCCTTGAATTCTAAATAAACCATTT ACCACCATGACC
What feature of rRNA makes co-transcriptional folding necessary for correct assembly of the ribosome? How do ribosomal proteins contribute to the formation of the conserved secondary structure of rRNA?
How does the mechanism of group I introns differ from that of group II introns? Which is more similar to the spliceosome-catalyzed reaction?
What three forms of RNA are found in both prokaryotes and eukaryotes? Why are these three common to all organisms?
Compare and contrast Rho-dependent and Rhoindependent termination. What is a common feature in both mechanisms?
What do you think about this solution?
We value your feedback to improve our textbook solutions.