/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 15 DNA polymerase requires both a t... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

DNA polymerase requires both a template, to be copied, and a primer, which provides a 3 ' hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG-OH

Short Answer

Expert verified
The sequence acts as both a template and primer, with a 3' hydroxyl group for initiation by DNA polymerase.

Step by step solution

01

Identify Key Components of the Molecule

The given molecule is: \( pTGACACAGGTTTAGCCCATCGATGGG-OH \). This sequence includes a series of nucleotide bases (G, C, T, A) which represent the DNA strand. It starts with a phosphate group denoted by 'p' and ends with an -OH group which is crucial for polymerase action.
02

Recognize the Template and Primer Requirements

DNA polymerase requires a template strand, which provides the sequence to be copied, and a primer with a free 3' hydroxyl (-OH) group, from where polymerase can add nucleotides.
03

Identify the Template Role of the Sequence

The sequence \( TGACACAGGTTTAGCCCATCGATGGG \) acts as a template since it provides the nucleotide sequence information needed for DNA synthesis. The enzyme uses each base to determine which nucleotide to add to the growing strand.
04

Locate the Primer Component

The -OH group at the end of this sequence acts as the primer's 3' hydroxyl group, necessary for DNA polymerase to add nucleotides. The sequence is inherently primed by this terminal -OH because it allows the polymerase to initiate DNA synthesis.
05

Explanation of Supporting DNA Polymerase Activity

This molecule supports DNA polymerase activity because it contains both the template information in the form of nucleotide sequence and a free 3' hydroxyl group, which is the point of initiation for polymerase action.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA Template
DNA polymerase requires a template to synthesize new DNA. A DNA template is essentially a sequence of nucleotides that guides the construction of a complementary strand. In the sequence \( TGACACAGGTTTAGCCCATCGATGGG \), each base serves as a guide for DNA polymerase. It reads the template strand, each nucleotide one by one, and directs the addition of complementary nucleotides to the growing DNA chain.

  • The template provides the necessary information to ensure that the sequence of the new DNA strand matches the intended genetic code.
  • Without a template, DNA polymerase cannot determine the correct sequence needed for DNA synthesis.
The DNA template does not produce a copy itself but instead ensures that the correct sequence is synthesized based on a complementary relationship. This is crucial for maintaining genetic fidelity.
DNA Primer
A DNA primer functions as a starting point for DNA synthesis. It is a short strand of nucleotides that provides a free 3' hydroxyl (-OH) group, which is essential for DNA polymerase to begin adding new nucleotide subunits to form a DNA strand. In the given sequence, the -OH group at the end serves this purpose.

  • The primer attaches to the DNA template strand to initiate replication.
  • It is usually synthesized by specific enzymes called primases in living cells, but here is represented by the initial sequence with an -OH group.
Without a primer, DNA polymerase would not have a starting point to begin DNA synthesis. The free 3' hydroxyl group is crucial as it provides the attachment site for incoming nucleotides.
Nucleotide Sequence
A nucleotide sequence consists of a series of nucleotides, which are the building blocks of DNA. Each nucleotide comprises a phosphate group, a sugar molecule, and a nitrogenous base. The sequence of these bases - adenine (A), guanine (G), cytosine (C), and thymine (T) - encodes the genetic information.

For example, in the provided sequence \( TGACACAGGTTTAGCCCATCGATGGG \), each base contributes a letter to the 'genetic sentence' being written.

  • The sequence determines the characteristics of the organism by specifying the order in which amino acids are assembled into proteins.
  • DNA polymerase utilizes the nucleotide sequence of the template strand to add complementary bases, creating a new DNA strand.
The nucleotide sequence is essential for the accurate replication and expression of genetic material.
DNA Synthesis
DNA synthesis is the process by which a new strand of DNA is produced, using an existing strand as a template. It is a fundamental aspect of cellular replication and division. DNA polymerase, an enzyme crucial to this process, links the building blocks of DNA in a sequence-specific manner.

  • It attaches to the DNA template and begins adding complementary nucleotides to the existing primer.
  • The enzyme moves along the template strand in a 3' to 5' direction, synthesizing the new strand in a 5' to 3' manner.
The synthesis is a coordinated action where the template directs the sequence of the nucleotides through complementary pairing. Ultimately, DNA synthesis replenishes DNA in cells during replication, ensuring genetic information is accurately passed on. Understanding this process is key to comprehending cellular growth and reproduction.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.