Chapter 4: Problem 15
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3 ' hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG-OH
Short Answer
Expert verified
The sequence acts as both a template and primer, with a 3' hydroxyl group for initiation by DNA polymerase.
Step by step solution
01
Identify Key Components of the Molecule
The given molecule is: \( pTGACACAGGTTTAGCCCATCGATGGG-OH \). This sequence includes a series of nucleotide bases (G, C, T, A) which represent the DNA strand. It starts with a phosphate group denoted by 'p' and ends with an -OH group which is crucial for polymerase action.
02
Recognize the Template and Primer Requirements
DNA polymerase requires a template strand, which provides the sequence to be copied, and a primer with a free 3' hydroxyl (-OH) group, from where polymerase can add nucleotides.
03
Identify the Template Role of the Sequence
The sequence \( TGACACAGGTTTAGCCCATCGATGGG \) acts as a template since it provides the nucleotide sequence information needed for DNA synthesis. The enzyme uses each base to determine which nucleotide to add to the growing strand.
04
Locate the Primer Component
The -OH group at the end of this sequence acts as the primer's 3' hydroxyl group, necessary for DNA polymerase to add nucleotides. The sequence is inherently primed by this terminal -OH because it allows the polymerase to initiate DNA synthesis.
05
Explanation of Supporting DNA Polymerase Activity
This molecule supports DNA polymerase activity because it contains both the template information in the form of nucleotide sequence and a free 3' hydroxyl group, which is the point of initiation for polymerase action.
Unlock Step-by-Step Solutions & Ace Your Exams!
-
Full Textbook Solutions
Get detailed explanations and key concepts
-
Unlimited Al creation
Al flashcards, explanations, exams and more...
-
Ads-free access
To over 500 millions flashcards
-
Money-back guarantee
We refund you if you fail your exam.
Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
DNA Template
DNA polymerase requires a template to synthesize new DNA. A DNA template is essentially a sequence of nucleotides that guides the construction of a complementary strand. In the sequence \( TGACACAGGTTTAGCCCATCGATGGG \), each base serves as a guide for DNA polymerase. It reads the template strand, each nucleotide one by one, and directs the addition of complementary nucleotides to the growing DNA chain.
- The template provides the necessary information to ensure that the sequence of the new DNA strand matches the intended genetic code.
- Without a template, DNA polymerase cannot determine the correct sequence needed for DNA synthesis.
DNA Primer
A DNA primer functions as a starting point for DNA synthesis. It is a short strand of nucleotides that provides a free 3' hydroxyl (-OH) group, which is essential for DNA polymerase to begin adding new nucleotide subunits to form a DNA strand. In the given sequence, the -OH group at the end serves this purpose.
- The primer attaches to the DNA template strand to initiate replication.
- It is usually synthesized by specific enzymes called primases in living cells, but here is represented by the initial sequence with an -OH group.
Nucleotide Sequence
A nucleotide sequence consists of a series of nucleotides, which are the building blocks of DNA. Each nucleotide comprises a phosphate group, a sugar molecule, and a nitrogenous base. The sequence of these bases - adenine (A), guanine (G), cytosine (C), and thymine (T) - encodes the genetic information.
For example, in the provided sequence \( TGACACAGGTTTAGCCCATCGATGGG \), each base contributes a letter to the 'genetic sentence' being written.
For example, in the provided sequence \( TGACACAGGTTTAGCCCATCGATGGG \), each base contributes a letter to the 'genetic sentence' being written.
- The sequence determines the characteristics of the organism by specifying the order in which amino acids are assembled into proteins.
- DNA polymerase utilizes the nucleotide sequence of the template strand to add complementary bases, creating a new DNA strand.
DNA Synthesis
DNA synthesis is the process by which a new strand of DNA is produced, using an existing strand as a template. It is a fundamental aspect of cellular replication and division. DNA polymerase, an enzyme crucial to this process, links the building blocks of DNA in a sequence-specific manner.
- It attaches to the DNA template and begins adding complementary nucleotides to the existing primer.
- The enzyme moves along the template strand in a 3' to 5' direction, synthesizing the new strand in a 5' to 3' manner.