/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 11 Assume that the translational er... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Assume that the translational error frequency, \(\delta\), is \(1 \times 10^{-4}\). (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000 -residue protein.

Short Answer

Expert verified
(a) 0.9900; (b) 0.9048.

Step by step solution

01

Define the Concept

The translational error frequency \( \delta \) is the probability of an error occurring at each residue. Therefore, \( 1 - \delta \) is the probability that no error occurs (a perfect residue). When synthesizing a protein of multiple residues, each residue must be error-free for the entire protein to be perfect.
02

Calculate Probability for a Single Residue

For each residue to be perfect, there must be no translational error. Thus, the probability of a single residue being correct is \( 1 - \delta \). Since \( \delta = 1 \times 10^{-4} \), the probability becomes \( 1 - 1 \times 10^{-4} = 0.9999 \).
03

Calculate Probability for 100-residue Protein

The probability of synthesizing a perfect protein made of 100 residues is the probability of having 100 perfect residues in sequence. This is calculated by raising the probability of a single residue being error-free to the power of 100, thus \( (0.9999)^{100} \). Calculating gives \( (0.9999)^{100} \approx 0.9900 \).
04

Calculate Probability for 1000-residue Protein

Similarly, the probability of getting a 1000-residue perfect protein is \( (0.9999)^{1000} \). Calculating this gives \( (0.9999)^{1000} \approx 0.9048 \).

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

protein synthesis
Protein synthesis is the process by which cells create new proteins, which are crucial for various cellular functions. This multistep process involves two main stages: transcription and translation.

  • Transcription occurs in the nucleus, where the DNA sequence of a gene is copied into messenger RNA (mRNA).
  • Translation happens in the cytoplasm, where ribosomes read the mRNA transcript to assemble the protein.
    • The ribosome reads the mRNA in sets of three nucleotides (codons), each representing an amino acid.
    • Transfer RNA (tRNA) molecules bring the corresponding amino acids to form the growing polypeptide chain.
Errors in translation can lead to incorrect amino acids being inserted into the protein sequence, potentially affecting protein function. The frequency of such errors, called translational error frequency, can impact the overall quality of protein synthesis.
probability calculation
Probability calculations are essential to predict the accuracy of biological processes, such as protein synthesis. In the given exercise, we calculate the likelihood of synthesizing a protein without errors.

The translational error frequency, represented by \delta, is the probability of an error occurring at each step of protein synthesis. Given \delta = 1 \times 10^{-4}, the probability of a single residue being correct is calculated as follows:
  • For a perfect residue, use the formula: \( 1 - \delta \).
  • Substitute the value of \delta: \( 1 - 1 \times 10^{-4} = 0.9999 \).
To find the probability of forming an error-free protein:
  • For a 100-residue protein: Raise this probability to the power of 100: \( (0.9999)^{100} \approx 0.9900 \).
  • For a 1000-residue protein: Raise it to the power of 1000: \( (0.9999)^{1000} \approx 0.9048 \).
These calculations illustrate how even minor errors, when multiplied across many residues, affect the overall likelihood of precise protein synthesis.
amino acid sequence
An amino acid sequence is the precise order of amino acids linked together in a protein, determined by the sequence of nucleotides in the mRNA.

  • Amino acids are the building blocks of proteins, and the sequence they form dictates the protein's structure and function.
  • The sequence is highly specific; even a single amino acid substitution can significantly affect protein activity.
In protein synthesis:
  • Each triplet of nucleotides on the mRNA (a codon) codes for a specific amino acid.
  • The translation process must be accurate to ensure that the correct amino acid chain, or polypeptide, is formed.
Understanding the composition of an amino acid sequence is essential for grasping how genetic information is translated into functional proteins. Therefore, minimizing translational errors is crucial to maintaining the integrity and functionality of the proteins required by the body.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The \(5^{\prime}\) sequence for the mRNA for E. coli ribosomal Llo protein is shown below. Identify the Shine-Dalgarno sequence and the initiator codon. $$ 5^{\prime} \text { - CUACCAGGAGCAAAGCUAAUGGCUUUA }-3^{\prime} $$

Chaperones are generally thought to facilitate protein folding. What additional functions do mitochondrial chaperones perform?

A random-sequence polyribonucleotide produced by polynucleotide phosphorylase, with CDP and ADP in a \(5: 1\) molar ratio stimulated the incorporation of proline, histidine, threonine, glutamine, asparagine, and lysine in a cell- free translation system in the following proportions: \(100,23.4,20,3.3,3.3\), and \(1.0\), respectively. What does this experiment reveal about the nucleotide composition of coding triplets for these six amino acids?

When polynucleotides are synthesized with repeating triplets of nucleotide residues, one, two, or three different polypeptide chains will be produced in cell-free synthesis. (a) Explain why these different results are possible. (b) Predict polypeptides produced when the following are used with an E. coli system: (GUA) \()_{11},(\mathrm{UUA})_{\mathrm{s}-}\)

A nonsense codon can be suppressed. Suppression is a mutation at an unlinked site that restores wild-type function at the mutant site without changing the original mutation. Suppression of nonsense mutations was found to alter the structures of particular tRNAs. Consider a nonsense mutation resulting from alteration of a trp codon and identify a specific mutation in a tRNAencoding gene that could result in translation of the nonsense codon.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.