/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 10 The sequence of part of an mRNA ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The sequence of part of an mRNA is \(5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3'\),What is the sequence of the DNA coding strand? Of the DNA template strand?

Short Answer

Expert verified
DNA coding strand: \(5'-ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG-3'\); DNA template strand: \(3'-TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCCTC-5'\).

Step by step solution

01

Understanding mRNA and DNA Relationship

The mRNA sequence given is a segment of the mRNA, which is complementary to the template strand of DNA. The mRNA sequence is generally written from the 5' to 3' direction, just like the coding strand of DNA. The coding strand in DNA is identical to the mRNA sequence, except that Thymine (T) is present instead of Uracil (U).
02

Determine the DNA Coding Strand

Replace the Uracil (U) in the mRNA sequence with Thymine (T) to obtain the DNA coding strand since this strand is identical to the mRNA sequence except for this base substitution. The DNA coding strand sequence is: \[ 5' - ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG - 3' \]
03

Determine the DNA Template Strand

The DNA template strand is the complementary strand of the coding strand and is used for RNA synthesis. To determine this, pair the bases of the coding strand with their complements: Adenine (A) with Thymine (T), Thymine (T) with Adenine (A), Cytosine (C) with Guanine (G), and Guanine (G) with Cytosine (C). The DNA template strand is:\[ 3' - TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCCTC - 5' \]
04

Verify the Complementarity

Check the complementary base pairs to ensure that each base follows the pairing rule correctly. Verify that the mRNA complements the template strand and the coding strand is identical to the mRNA strand excluding T/U difference.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

mRNA sequence
Messenger RNA (mRNA) is a crucial molecule in the process of gene expression. It acts as the intermediary between the genetic information encoded in DNA and the synthesis of proteins, the building blocks of life. The sequence of an mRNA is complementary to the DNA template strand from which it is transcribed. This means during transcription, the DNA's bases are paired with complementary RNA bases:
  • Adenine (A) pairs with Uracil (U) instead of Thymine (T) since RNA does not use Thymine.
  • Cytosine (C) pairs with Guanine (G).
Consequently, the mRNA sequence is a mirror image of the template strand but with U instead of T. An important point to remember is that mRNA sequences are always written in the 5' to 3' direction, which mirrors the directionality of the DNA coding strand.
DNA coding strand
The DNA coding strand is one of the two strands of a DNA double helix. It is equivalent to the mRNA sequence produced during transcription, except that in DNA, the base Thymine (T) is present instead of Uracil (U). This strand is called "coding" because its sequence directly corresponds to the genetic code read during translation to produce proteins. Hence:
  • The coding strand has the same sequence as mRNA but with T instead of U.
  • It runs in the 5' to 3' direction, just like the mRNA.
This strand does not serve as the template during transcription but is a direct output product of its complementary partner, the template strand.
DNA template strand
The DNA template strand serves as the actual template used during transcription to build mRNA. This strand is crucial as it directs the sequence of the nucleotides in the newly synthesized mRNA. Specific rules dictate base pairing between the template strand of DNA and the mRNA being synthesized:
  • Adenine on the template pairs with Uracil in RNA.
  • Thymine pairs with Adenine.
  • Cytosine pairs with Guanine.
  • Guanine pairs with Cytosine.
This strand runs in the 3' to 5' direction, opposite to that of the mRNA and the coding strand. It's important to remember that during transcription, the template strand's sequence gets "translated" into a complementary mRNA sequence following these base pairing rules, leading to protein synthesis during the next phase of gene expression.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.