/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 4 How does the use of restriction ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

How does the use of restriction endonucleases of different specificities aid in the sequencing of DNA?

Short Answer

Expert verified
Using restriction endonucleases of different specificities results in unique DNA fragments. By mapping and sequencing these fragments, scientists can determine the entire DNA sequence accurately.

Step by step solution

01

- Understanding Restriction Endonucleases

Restriction endonucleases are enzymes that cut DNA at specific nucleotide sequences. Different restriction endonucleases have different specificities, meaning they recognize and cut at different sequences.
02

- DNA Fragmentation

Using restriction endonucleases of different specificities helps to cut the DNA into smaller, manageable fragments. Each enzyme cuts at its specific sequence, producing a pattern of DNA fragments unique to the enzyme used.
03

- Mapping DNA Fragments

By mapping the locations of these cuts, scientists can determine the order of fragments. Overlapping fragments are analyzed to assemble the entire sequence.
04

- Sequencing Techniques

After fragmentation, sequencing techniques such as Sanger sequencing can be employed. The fragments are sequenced individually, and the overlapping sequences are used to piece together the full DNA sequence.
05

- Comparing Sequences

By using multiple enzymes, scientists can cross-verify the sequences obtained to ensure accuracy and completeness. This reduces errors and helps in achieving a more reliable DNA sequence.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA Fragmentation
DNA fragmentation is a critical initial step in the process of sequencing DNA. It involves breaking down large molecules of DNA into smaller, more manageable pieces. This is generally achieved using restriction endonucleases, which are enzymes that recognize specific sequences of nucleotides within the DNA and make precise cuts at those locations. By doing this, scientists create a collection of smaller DNA fragments, each of which contains a part of the original DNA sequence.
Using different restriction enzymes that have varying specificities allows for multiple fragment patterns. This diversity in fragmentation is helpful when mapping and sequencing the DNA, as it ensures that various parts of the DNA are cut into fragments, helping to cover the entire sequence.
DNA Sequencing
DNA sequencing is the process of determining the exact order of nucleotides within a DNA molecule. Once DNA is fragmented using restriction endonucleases, the smaller pieces can then be sequenced using various sequencing techniques. Sequencing technologies have advanced greatly over the years, but traditional methods like Sanger sequencing remain foundational.
During DNA sequencing, each fragment is analyzed to determine its specific nucleotide sequence. By piecing together these sequences from multiple fragments, scientists can reconstruct the original DNA sequence, gaining insights into genetic information and functions.
Restriction Enzymes Specificity
Restriction enzymes, also known as restriction endonucleases, are highly specific proteins that cut DNA at particular recognition sites. Each type of restriction enzyme recognizes a unique sequence of nucleotides, usually 4-8 bases long, and cuts the DNA at or near these sites. This specificity is critical because it allows for precise cutting of DNA, which is necessary for creating consistent and repeatable fragments.
By choosing restriction enzymes with different specificities, scientists can create different sets of DNA fragments. This versatility is important for comprehensive DNA mapping and sequencing, as it ensures that all parts of the DNA are considered and reduces the chances of missing critical sections.
Mapping DNA Fragments
Mapping DNA fragments involves determining the order and position of fragments relative to one another. After the DNA is fragmented by restriction enzymes, each piece must be mapped so scientists can understand how the fragments overlap and fit together.
Mapping typically uses the known sequence specificity of the restriction enzymes. Overlapping fragments are cross-referenced to piece them together accurately. This process is essential in larger sequencing projects as it helps to organize and structure the sequence data, making it easier to reconstruct the overall DNA sequence.
Sanger Sequencing
Sanger sequencing, named after its inventor Frederick Sanger, is one of the earliest methods developed for DNA sequencing. This method, also known as the chain-termination method, sequences DNA by synthesizing complementary strands and incorporating chain-terminating nucleotides. These terminated strands are then analyzed to determine the DNA sequence.
In Sanger sequencing, after DNA fragmentation, each fragment is incorporated into the sequencing process where special nucleotides stop the DNA synthesis at each of the four bases (adenine, thymine, cytosine, guanine). The resulting fragments differ in length and are separated by electrophoresis. By reading the gel electrophoresis patterns, scientists can deduce the specific nucleotide sequence of each fragment. The overlapping sequences from fragmented DNA help to piece together the full DNA sequence.
Combining Sanger sequencing with restriction enzyme digestion ensures the accuracy of long sequences by confirming overlapping and complementary sequences across various fragments.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

What are the key differences between DNA microarrays and protein microarrays, and how they are used in research?

Although techniques are available for determining the sequences of amino acids in proteins, it is becoming more and more common to sequence proteins indirectly by determining the base sequence of the gene for the protein and then inferring the amino acid sequence from the genetic-code relationships. Suggest why the latter technique is being used for proteins.

What do the following have in common? MOM; POP; NOON; MADAM, I'M ADAM; A MAN, A PLAN, A CANAL: PANAMA.

Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer \(5^{\prime}\) GCCTCCGGAGACCCATTGG \(3^{\prime}\) Reverse primer \(5^{*}\) TICTAAGAAACTGTTAAGG \(3^{\prime}\) (b) Forward primer \(5^{\prime}\) GGGGCCCCTCACTCGGGGCCCC \(3^{\prime}\) Reverse primer \(5^{\prime}\) TCGGCGGCCGTGGCCGAGGCAG \(3^{\prime}\) (c) Forward primer \(5^{\prime}\) TCGAATTGCCAATGAAGGTCCG \(3^{\prime}\) Reverse primer \(5^{\prime}\) CGGACCTTCATTGGCAATTCGA \(3^{\prime}\)

A television commercial featuring former cyclist Lance Armstrong talked about the possibility of people carrying a DNA genotype card with them that would contain all of the information necessary to predict future diseases. This could, therefore, be used to help prescribe drugs to stop a medical condition before it became apparent. Give a couple of specific examples of how this ability could be used for the benefit or the detriment of humankind.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.