Chapter 13: Problem 8
Where did restriction endonucleases get their name?
Short Answer
Step by step solution
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none}
Learning Materials
Features
Discover
Chapter 13: Problem 8
Where did restriction endonucleases get their name?
These are the key concepts you need to understand to accurately answer the question.
All the tools & learning materials you need for study success - in one app.
Get started for free
Why do some journals require the authors of articles describing DNA libraries to make those libraries available to other researchers?
Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?
A recent television commercial featuring seventime Tour de France winner Lance Armstrong talked about the possibility of people carrying a DNA genotype card with them that would contain all of the information necessary to predict future diseases. This could, therefore, be used to help prescribe drugs to stop a medical condition before it became apparent. Give a couple of specific examples of how this ability could be used for the benefit or the detriment of humankind.
The genes for both the \(\alpha\) - and \(\beta\) -globin chains of hemoglobin contain introns (i.e., they are split genes). How would this fact affect your plans if you wanted to introduce the gene for \(\alpha\) -globin into a bacterial plasmid and have the bacteria produce \(\alpha\) -globin?
Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer \(5^{\prime}\) GCCTCCGGAGACCCATTGG \(3^{\prime}\) Reverse primer \(5^{\prime}\) TTCTAAGAAACTGTTAAGG \(3^{\prime}\) (b) Forward primer \(5^{\prime}\) GGGGCCCCTCACTCGGGGCCCC \(3^{\prime}\) Reverse primer \(5^{\prime}\) TCGGCGGCCGTGGCCGAGGCAG \(3^{\prime}\) (c) Forward primer 5 ' TCGAATTGCCAATGAAGGTCCG \(3^{\text {' }}\) Reverse primer \(5^{\prime}\) CGGACCTTCATTGGCAATTCGA \(3^{\prime}\)
What do you think about this solution?
We value your feedback to improve our textbook solutions.