/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 8 Where did restriction endonuclea... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Where did restriction endonucleases get their name?

Short Answer

Expert verified
Restriction endonucleases are named for their role in restricting the presence of foreign DNA by cutting it at specific sequences.

Step by step solution

01

- Understand the Term 'Restriction Endonucleases'

Restriction endonucleases are enzymes that cut DNA at specific sequences. The term 'endonuclease' refers to enzymes that cleave the phosphodiester bond within a nucleotide chain.
02

- Break Down 'Restriction'

The word 'restriction' comes from the ability of these enzymes to restrict or cut down the virus or foreign DNA. They function as a defense mechanism in bacteria against invading viruses.
03

- Historical Context

These enzymes were discovered in bacteria, where they serve as an immune system by recognizing specific sequences of foreign DNA and cutting them. Their name reflects their role in this restriction process.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA Cutting Enzymes
Restriction endonucleases are also known as DNA cutting enzymes. These enzymes have the special ability to cut DNA at precise points. They are highly specific and recognize particular sequences in the DNA to make their cuts.
In simple terms, think of restriction endonucleases as molecular scissors that can cut DNA molecules in specific places. This cutting action is crucial for various techniques in molecular biology, such as cloning and DNA fingerprinting.
Understanding these enzymes helps us see how scientists can manipulate and study DNA effectively.
Phosphodiester Bond Cleavage
One important aspect of restriction endonucleases is their ability to cleave, or break, phosphodiester bonds. Phosphodiester bonds are the links between sugar and phosphate groups in DNA's backbone.
When a restriction endonuclease finds its specific DNA sequence, it cuts the DNA by cleaving these bonds. This action can create 'blunt' or 'sticky' ends, depending on how the enzyme cuts.
Sticky ends have overhanging pieces of single-stranded DNA, which can easily join with other DNA fragments cut by the same enzyme. Blunt ends, on the other hand, are straight cuts through the DNA. Both types of cuts are useful in different genetic engineering techniques.
Bacterial Defense Mechanism
Restriction endonucleases play a crucial role as a bacterial defense mechanism against invaders like viruses, known as bacteriophages.
Bacteria use these enzymes to protect themselves by recognizing and cutting the DNA of invading viruses. They identify specific sequences in the foreign DNA and cut it, preventing the virus from taking over the bacterial cell.
This is a natural immune response in bacteria, similar to how our immune system fights off infections.
Interestingly, bacteria protect their own DNA from being cut by these enzymes through a process called methylation. They add methyl groups to their DNA at the recognition sites, making it invisible to the restriction endonuclease.
  • In summary, restriction endonucleases got their name because they restrict the growth of viruses by cutting their DNA.
  • This fascinating process not only helps bacteria survive but also provides scientists with valuable tools for genetic research.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Why do some journals require the authors of articles describing DNA libraries to make those libraries available to other researchers?

Why is the use of temperature-stable DNA polymerase an important factor in the polymerase chain reaction?

A recent television commercial featuring seventime Tour de France winner Lance Armstrong talked about the possibility of people carrying a DNA genotype card with them that would contain all of the information necessary to predict future diseases. This could, therefore, be used to help prescribe drugs to stop a medical condition before it became apparent. Give a couple of specific examples of how this ability could be used for the benefit or the detriment of humankind.

The genes for both the \(\alpha\) - and \(\beta\) -globin chains of hemoglobin contain introns (i.e., they are split genes). How would this fact affect your plans if you wanted to introduce the gene for \(\alpha\) -globin into a bacterial plasmid and have the bacteria produce \(\alpha\) -globin?

Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer \(5^{\prime}\) GCCTCCGGAGACCCATTGG \(3^{\prime}\) Reverse primer \(5^{\prime}\) TTCTAAGAAACTGTTAAGG \(3^{\prime}\) (b) Forward primer \(5^{\prime}\) GGGGCCCCTCACTCGGGGCCCC \(3^{\prime}\) Reverse primer \(5^{\prime}\) TCGGCGGCCGTGGCCGAGGCAG \(3^{\prime}\) (c) Forward primer 5 ' TCGAATTGCCAATGAAGGTCCG \(3^{\text {' }}\) Reverse primer \(5^{\prime}\) CGGACCTTCATTGGCAATTCGA \(3^{\prime}\)

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.