/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 4 A DNA template plus primer with ... [FREE SOLUTION] | 91影视

91影视

A DNA template plus primer with the structure $$\begin{aligned} &3^{\prime} \mathrm{P}-\text { TGCGAATTAGCGACAT }-\mathrm{P} 5^{\prime}\\\ &5^{\prime} \mathrm{P}-\mathrm{ATCGGTACGACGCTTAAC}-\mathrm{OH} 3^{\prime} \end{aligned}$$ (where \(P=\) a phosphate group) is placed in an in vitro DNA synthesis system \(\left(\mathrm{Mg}^{2+}\right.\) an excess of the four deoxyribonucleoside triphosphates, etc.) containing a mutant form of \(E .\) coli DNA polymerase I that lacks \(5^{\prime} \rightarrow 3^{\prime}\) exonuclease activity. The \(5^{\prime} \rightarrow 3^{\prime}\) polymerase and \(3^{\prime} \rightarrow 5^{\prime}\) exonuclease activities of this aberrant enzyme are identical to those of normal \(E\). coli DNA polymerase I. It simply has no \(5^{\prime} \rightarrow 3^{\prime}\) exonuclease activity. (a) What will be the structure of the final product? (b) What will be the first step in the reaction sequence?

Short Answer

Expert verified
The first step is primer elongation, and the final product is an extended primer.

Step by step solution

01

Analyze the DNA Template and Primer

The DNA template is given as \(3^{\prime} \mathrm{P} - \text{TGCGAATTAGCGACAT} - \mathrm{P} 5^{\prime}\), and the primer is \(5^{\prime} \mathrm{P} - \text{ATCGGTACGACGCTTAAC} - \mathrm{OH} 3^{\prime}\). The primer has an OH group at the 3' end, which is necessary for DNA polymerase to start adding nucleotides.
02

Understand the Mutant Polymerase

The mutant \(E. coli\) DNA polymerase I lacks \(5^{\prime} \rightarrow 3^{\prime}\) exonuclease activity but retains \(5^{\prime} \rightarrow 3^{\prime}\) polymerase activity and \(3^{\prime} \rightarrow 5^{\prime}\) exonuclease activity. This means it can synthesize DNA in the 5' to 3' direction and correct errors with the 3' to 5' exonuclease activity.
03

Elongation of the Primer

The first step in synthesis is elongation. The 3' OH end of the primer aligns with the 3' end of the template. DNA polymerase will add nucleotides complementary to the template strand to the 3' end of the primer. The sequence to be added will be complementary to \(3^{\prime} \text{TGCGAATTAGCGACAT} 5^{\prime}\), resulting in \(3^{\prime}\) CATCGCGAATTCGGA 5' extension.
04

Final Product Structure

The final product will have a structure where the primer has been extended by adding nucleotides complementary to the template strand. The new sequence is \(5^{\prime} \mathrm{P} - \text{ATCGGTACGACGCTTAACCATCGCGAATTCGGA} - \mathrm{OH} 3^{\prime}\).

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA polymerase
DNA polymerase is an essential enzyme in DNA replication. It is responsible for synthesizing the DNA strand by adding nucleotide units one at a time to a growing DNA chain. DNA polymerases require a DNA template and a primer in order to start synthesis.
The enzyme works by catalyzing the addition of deoxyribonucleotide triphosphates (dNTPs) to the 3' end of the DNA primer, elongating the DNA chain.
While performing this function, DNA polymerase requires metal ions, often magnesium ions (Mg虏鈦), to facilitate the reaction.
  • Catalytic function: Adds dNTPs to the growing DNA strand.
  • Specificity: Requires a primer with a free 3'-OH group to initiate synthesis.
  • Enhancers: Often works in an environment rich with necessary ions and nucleotides.
Exonuclease activity
Exonuclease activity refers to the enzyme's ability to remove nucleotide bases at the end of a DNA strand. This function is crucial for proofreading and error correction during DNA synthesis. DNA polymerase I from \(E. coli\) demonstrates two types of exonuclease activities:
1. **3' to 5' Exonuclease Activity:** Allows the polymerase to remove incorrectly paired bases, thereby ensuring the fidelity of DNA replication. This activity enables the correction of errors after incorrect nucleotides have been added.
2. **5' to 3' Exonuclease Activity:** This activity, absent in the mutant \(E.coli\) DNA polymerase I mentioned in the exercise, helps with the removal of RNA primers and damaged DNA sections during replication.Without the 5' to 3' exonuclease activity, this particular mutant enzyme still ensures accurate DNA synthesis by relying on its 3' to 5' exonuclease capability.
DNA template and primer
The DNA template and primer are fundamental components needed by DNA polymerase to initiate DNA synthesis. The template strand serves as the guide for the synthesis of a new complementary strand, ensuring the accurate replication of the DNA sequence.
  • **DNA Template:** This strand is read by DNA polymerase to synthesize a complementary sequence. In this exercise, the template is represented by the sequence \(3'\ to\ 5'\), which the polymerase reads to add matching nucleotides.
  • **Primer:** A short, pre-existing strand of nucleotides with a free 3' hydroxyl group (-OH) to which new nucleotides can be added by the polymerase. Here, the primer is given as \(5'\ to\ 3'\) and sequences nucleotides on it that match the template, extending the DNA chain.
This pairing and usage allow DNA polymerase to correctly extend the growing DNA strand from the primer.
In vitro DNA replication
In vitro DNA replication is the process of replicating DNA outside a living organism, in a controlled lab environment. This approach uses key principles of cellular DNA replication to mimic the process artificially.
It requires essential components such as template DNA, a primer, DNA polymerase, and dNTPs. The exercise describes an in vitro setup involving these components.
  • **Components:** Besides DNA and primers, in vitro systems require excess dNTPs and Mg虏鈦 ions necessary for the function of DNA polymerase.
  • **Controlled Conditions:** In vitro setups allow researchers to study specific aspects of DNA replication, including enzyme function and mutation effects.
  • **Utility:** Useful for experiments on DNA replication mechanisms, sequencing, and various molecular biology applications.
This simulated environment is invaluable for studying fundamental DNA synthesis processes, including the effects of specific mutations or conditions.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.