/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 15 If a scientist synthesizes a DNA... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

If a scientist synthesizes a DNA molecule with the nucleotide base sequence TACGGGGGAGGGGGAGGGGGA and then uses it for transcription and translation, what would be the amino acid sequence of the product?

Short Answer

Expert verified
The amino acid sequence of the product is Methionine-Proline-Proline-Proline or Met-Pro-Pro-Pro.

Step by step solution

01

Transcribe the DNA into mRNA

The DNA sequence provided is TACGGGGGAGGGGGAGGGGGA. During the process of transcription, RNA is synthesized from the DNA sequence. The RNA uses Uracil (U) instead of Thymine (T). Therefore, the DNA sequence transcribes to the following mRNA sequence: AUGCCCCCUCCCCCUCCCCCU.
02

Translate the mRNA into Amino Acids

The mRNA sequence AUGCCCCCUCCCCCUCCCCCU would then undergo translation, where every three nucleotides (known as a codon) on mRNA codes for a specific amino acid. Therefore, the mRNA sequence would translate into the following amino acids: AUG -> Methionine (Met), CCC -> Proline (Pro), CCC -> Proline (Pro), CCU -> Proline (Pro). Thus the amino acid sequence will be: Met-Pro-Pro-Pro.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Nucleotide Base Sequence
The nucleotide base sequence is a vital concept in genetics. It's the specific order of nucleotides within a DNA molecule. These nucleotides include adenine (A), thymine (T), cytosine (C), and guanine (G). They pair in a very specific way: A with T and C with G in DNA.
The sequence determines the genetic information carried by the DNA, essentially acting as a blueprint for the organism's cellular machinery. Understanding this sequence is crucial because it serves as the starting point for processes like transcription and translation that lead to protein synthesis.
mRNA Synthesis
mRNA synthesis, also known as transcription, is the first step in decoding a cell’s genetic information. During this process, the DNA sequence is copied into messenger RNA (mRNA). An enzyme called RNA polymerase "reads" the DNA strand and constructs the mRNA.
In this synthesis, uracil (U) is used in place of thymine (T). This means wherever there is adenine on the DNA, uracil will pair with it on the mRNA. For example, if the DNA sequence is TAC, the corresponding mRNA sequence will be AUG.
Amino Acid Sequence
An amino acid sequence is the specific arrangement of amino acids in a polypeptide chain, which later folds into a functional protein. This sequence is dictated by the mRNA sequence being translated.
Each amino acid is like a letter in a sentence, and the order determines the protein's structure and function. For instance, the sequence Met-Pro-Pro-Pro applies to proteins that are crucial for various cellular processes. Changes in these sequences can lead to different proteins, affecting an organism's traits or functions.
Codons
Codons are sequences of three nucleotides on mRNA that correspond to specific amino acids. These groups of three are fundamental in the process of translation, wherein mRNA is decoded to synthesize proteins.
Each codon matches one amino acid or a starting/stopping signal for synthesis. For instance, AUG is the start codon and also translates to Methionine. CCC is another codon that translates to Proline. By recognizing these codons, cells can accurately build proteins.
Protein Synthesis
Protein synthesis is the biological process through which cells assemble proteins. It consists of two main stages: transcription (writing down the genetic code into mRNA) and translation (using that code to construct proteins).
The mRNA sequence, read by the ribosome, is translated into an amino acid sequence, which then folds into a specific three-dimensional structure to perform various functions. Protein synthesis is fundamental to maintaining cell structure, enabling biochemical reactions, and supporting cellular communication and repair.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.